Лада 09: Купить LADA (ВАЗ) 2109 с пробегом по цене от 25 000 рублей

Содержание

Четыре гандболистки «Лады» получили вызов на УТС национальной сборной России

МОСКВА. 7 АПРЕЛЯ. ВОЛГА НЬЮС.

Читали: 284

Версия для печати

Если вы нашли ошибку в тексте — выделите ее и нажмите CTR+Enter

Четыре гандболистки «Лады» (Алена Амельченко, Валерия Кирдяшева, Ольга Фомина и Ольга Щербак) получили вызов на УТС национальной сборной России, который пройдет с 15 по 23 апреля в подмосковном Новогорске.

Для Амельченко, в отличие от трех других тольяттинских «сборниц», которые в декабре прошлого года участвовали в чемпионате мира в Испании, приглашение в главную команду страны — неординарное событие. Впервые в карьере она получила вызов в нее еще в 2013 г., несколько раз побывала в первой сборной в 2018-м, в том числе сразу после перехода из «Звезды» в «Ладу». Но все это были либо летние, либо предматчевые сборы в расширенном составе команды накануне игр различных квалификационных турниров, а принять участие хотя бы в одном матче национальной дружины ей пока не довелось. Есть стопроцентный шанс сделать это сейчас.

Планируется, что на завершающем этапе предстоящего УТС подопечные Людмилы Бодниевой сыграют в Москве на турнире «OLIMPBET Кубок дружбы» с участием национальных сборных Белоруссии и Китая, а также молодежной сборной России.

Последние новости

Автоваз 21096107018Уплотнитель двери ВАЗ Лада 2109-099, 2115 передней

Свернуть карточку товараСамый дешевый

332 ₽

вторник 26.04

Самый быстрый

396 ₽

вторник 19.04

Уровень цен: ОПТ

Выбрать пункт выдачи заказов на карте

Запрошенный номер

Производитель и номер

Описание

Наличие

Срок

Цена

21096107018

На нашем складе

Уплотнитель двери передний В-2109 завод

1 шт.

386 ₽

Уплотнитель двери ВАЗ 2109-099,15 (БРТ)

4 шт.

771 ₽

Другие предложения

Автозапчасть/уплотнитель двери ваз 2109-099, 2115

1 шт.

332 ₽

Еще 10 предложений 

от 5 дн

от 357 ₽

Аналоги для номера

Производитель и номер

Описание

Наличие

Срок

Цена

Уплотнитель двери ВАЗ-2108 в бухтах 50 м

200 шт.по 50 шт

113 ₽

Уплотнитель проема передней двери ВАЗ-2109 102315

20 шт.

319 ₽

Уплотнитель проема передней двери ВАЗ-2109

10 шт.

335 ₽

Уплотнитель проема передней двери ВАЗ-2109

586 шт.

345 ₽

Еще 2 предложения 

от 5 дн

от 350 ₽

Уплотн. проема пер.двери 09 (БРТ)

253 шт.

304 ₽

БалаковоЗапчасть

Э/00001632 /БРТ/Уплотнитель проема двери 2109, 2115 перед.

88 шт.

322 ₽

Уплотнитель двери ВАЗ-2109, 2114 передний к-т.4шт БЗ иу

9 шт.

2 108 ₽

Уплотнитель двери ВАЗ-2109 проёма к-т 4шт БалаковоЗапчасть

3 шт.

2 197 ₽

Уплотнитель проема двери В2109/15

7 шт.

336 ₽

Уплотнитель проёма двери 2109 передней (L=3450)

7 шт.

555 ₽

Уплотнитель двери ВАЗ-2109 задний, шт

2 шт.

620 ₽

Резинотехника

А/ГО000037 /Екатеринбург/Уплотнитель проема двери В2109/15

7 шт.

348 ₽

Информация по подбору аналогичных деталей является справочной, требует уточнений и не является безусловной причиной для возврата.
Изображение детали на фотографии может отличаться от аналогов. В наименовании запчастей допускаются ошибки из-за не точности перевода с иностранных прайсов.

Технические характеристики ВАЗ (Lada) 2109 (VAZ (Лада) 2109) 1.6 MT 1987-2006

Технические характеристики ВАЗ (Lada) 2109 (VAZ (Лада) 2109) 1.6 MT 1987-2006. На этой странице вы узнаете особенности и характеристики ВАЗ (Lada) 2109: 21099 седан, дорожный просвет (клиренс) и многое другое.

Колея задних колёс 1370 мм
Ширина 1650 мм
Колея передних/задних колёс 1 400/1 370 мм
Дорожный просвет 160 мм
Высота 1402 мм
Объём багажника до 400 л
Снаряженная масса 970 кг
Колёсная база 2460 мм
Допустимая полная масса 1395 кг
Количество мест 5
Колея передних колёс 1400 мм
Максимальный объём багажника 400 л
Длина 4205 мм
Длина x Ширина x Высота 4 205 x 1 650 x 1 402 мм
Количество клапанов на цилиндр
2
Наличие интеркулера Нет
Тип двигателя Бензиновый
Объём двигателя 1598 см3
Диаметр цилиндра 82 мм
Конфигурация двигателя Рядный
Мощность двигателя 80 л.с.
Ход поршня 71 мм
Тип впуска Инжектор
Обороты максимальной мощности, макс. 5600 об/мин
Максимальный крутящий момент 120 Н•м
Обороты максимальной мощности до 5 600 об/мин
Количество цилиндров 4
Обороты максимального крутящего момента до 2 700 об/мин
Обороты максимального крутящего момента, макс. 2700 об/мин
Привод Передний
Количество ступеней
5
Коробка передач Механика
Задние тормоза Барабанные
Передняя подвеска Амортизационная стойка
Задняя подвеска Винтовые пружины
Передние тормоза Дисковые
Расход топлива в смешанном цикле 7.7 л/100 км
Время разгона до 100 км/ч 14 сек
Объём топливного бака 43 л
Запас хода от 430 до 750 км
Максимальная скорость 160 км/ч
Рекомендуемое топливо Аи-95
Расход топлива в городе 9.9 л/100 км
Экологический стандарт Euro iii
Расход топлива на шоссе 5.7 л/100 км
Усилитель руля Отсутствует
Количество крепёжных отверстий 4
Диаметр обода 13
Количество крепёжных отверстий 4
Диаметр обода 13
Ширина профиля шины 165
Высота профиля шины 70
Диаметр шины 13
Высота профиля шины 70
Диаметр шины 13
Ширина профиля шины
165
Коробка передач Механика, 5 ст.
Привод Передний

СМИ назвали модели Lada, которые упростят первыми | TLT.ru

АВТОВАЗ выпустит первые упрощенные модели «Лада» в июне. Первым авто, лишенным ABS/ESP, «ЭРА-ГЛОНАСС» и подушек безопасности, станет «Гранта». А в июле выпустят старую Ниву (ВАЗ-21214), ныне называемую Legend. Она упрощается по тому же лекалу, пишет портал drom.ru со ссылкой на собственные источники на заводе.

Ранее предполагалось, что первые подобные «Лады» завод выпустит уже в мае, но, как говорят, «молодежь в конструкторском отделе не привыкла работать в режиме аврала и все получается медленнее, чем хотелось бы».

При этом первые упрощенные экземпляры «Гранты», предназначенные для сертификации, уже собраны. В Тольятти ждут официальной подписи под текстом специальной версии Техрегламента, позволяющей сертифицировать автомобили по упрощенным нормам.

Издание отмечает, что новые модификации будут соответствовать второму экологическому классу (нормы «Евро-2»). Соответственно, изменяются настройки в ECU (блоке управления двигателем), удаляется второй датчик содержания кислорода (лямбда-зонд), но непонятно пока, сохраняется ли катаколлектор.

На вопрос о цене упрощенных модификаций источник заявил, что должно быть дешевле, но кто знает, какая ситуация с ценами будет в июне.

Упрощенных модификаций «Весты» пока не планируется, там так организованы цепочки поставок, что, даже удалив из машины ABS/ESP, «ЭРА-ГЛОНАСС» и подушки безопасности, не получают стопроцентной локализации.

Ранее в АВТОВАЗе сообщили, что параллельно ведётся активная работа по поиску альтернативных решений для ключевых импортных компонентов для скорейшего возвращения к производству стандартных модификаций. В компании отметили, что приветствуют решение Минпромторга, который предложил принять технический регламент, позволяющий снизить требования к безопасности выпускаемых в стране машин.

До этого губернатор Дмитрий Азаров сообщил, что АВТОВАЗ нашел поставщиков электронных компонентов, это компании из стран Азии.

23 марта Renault заявила о приостановке деятельности в России. Сообщалось, что компания рассматривает возможность передачи своей доли в АВТОВАЗе местному инвестору.

В марте компания дважды повысила цены на всю модельную линейку Lada. Повышение оказалось рекордным

.

В Харовском районе фельдшеру вручили ключи от служебного автомобиля «Лада Ларгус»

12.04.22 / 15:40

Андрей Иванов

Фото: группа «Администрация Харовского района» в ВКонтакте

Ключи от служебного автомобиля «Лада Ларгус» получила фельдшер Харовской ЦРБ Нина Проворова, которая обслуживает сразу два ФАПа, в которых лечатся свыше трехсот человек. 

Как сообщает группа «Администрация Харовского района» в социальной сети ВКонтакте, автомобиль поступил в Харовскую ЦРБ по областной программе модернизации первичного звена национального проекта «Здравоохранение».

Фельдшер Нина Проворова обслуживает Сорожинский и Ивачинский ФАПы. В Ивачино охват медицинской помощью составляет более 100 человек, в Сорожино – свыше 220, а в летний период – примерно в два раза больше. Расстояние от одного ФАПа до другого составляет девять километров. У фельдшера есть водительские права, и теперь это расстояние для нее – не помеха.

Добавим, что в ФАПах есть небольшие аптечные пункты, и теперь фельдшер может оперативно пополнять их лекарствами из центральной аптеки. Кроме того, жители села смогут на автомобиле доехать до Центральной районной больницы на прием или диспансеризацию.

В Харовском районе фельдшеру вручили ключи от служебного автомобиля «Лада Ларгус»

В Харовском районе фельдшеру вручили ключи от служебного автомобиля «Лада Ларгус»

В Харовском районе фельдшеру вручили ключи от служебного автомобиля «Лада Ларгус»

Фотогалерея Lada Samara: Фото #09 из 13, размер изображения

Chevrolet Celta

Chevrolet Celta (Шевроле Сельта) выпускается с тремя или пятью дверями в кузове хэтчбэк и относится к классу В. Выпуск данной модели начинает свою историю в 2000 году.

Subaru Outback

Subaru Outback считается одним из первых кроссоверов от японского автомобильного концерна Subaru. Первое поколение этих автомобилей поступило в продажу еще в 1995 году.

Lexus GS III

Дизайн автомобилей с задним приводом GS 430 и GS 300 был разработан с учетом концепции под названием «Утонченность». Данные автомобили отличаются высоким уровнем безопасности, благодаря чему они заслуженно обладают пятью звездами в испытаниях Евро NCAP.

Porsche 911 Carrera 997

Автомобиль Porsche 911 Carrera 997 положил начало пятому поколению машин модели 911, которые были оснащены кузовом, а также заводским индексом 997. Интересно, что первая демонстрация автомобиля была произведена для журналистов летом 2004 г.

Tatra T613

Автомобиль Tatra T613 – это авто представительского класса от автомобильной компании Tatra, серийное производство которого продолжалось с 1974 по 1996 год. Впрочем, первые концепции T613 были разработаны итальянскими инженерами на основе чехословацких конструкций ещё в 1969 году, и изначально на рынок планировалось поставлять два варианта кузова: седан и купе.

Водные агентства, фермеры обеспокоены переходом Калифорнии к регулированию — Water Deeply

Управление бассейнами пополнения подземных вод и ирригационными прудами может стать более проблематичным в соответствии с планом Калифорнии по противодействию отказу администрации Трампа от защиты водно-болотных угодий, говорят отраслевые эксперты.

Штат Калифорния работает над новой программой регулирования для надзора за защитой водно-болотных угодий и других временных водоемов, таких как сезонные ручьи. Это происходит в ответ на план администрации Трампа по отказу от федеральной защиты таких вод, которые имеют решающее значение для среды обитания диких животных, защиты от наводнений, пополнения запасов подземных вод и качества воды.

Water Глубоко подробно изучил предложение штата в статье, опубликованной на этой неделе. Но что эта широкая новая программа регулирования в Калифорнии будет означать для водной отрасли и застройщиков в штате?

Ряд отраслевых экспертов собрались для обсуждения именно этого вопроса на прошлогодней конференции Ассоциации водохозяйственных агентств Калифорнии. Ниже приведены основные моменты этой презентации, сжатые из более длинной стенограммы, первоначально опубликованной MavensNotebook.com. Он публикуется здесь с разрешения.

Это гораздо более широкая новая разрешительная программа

Федеральный закон о чистой воде содержит подробные сведения о том, как разграничить водно-болотные угодья на западе Соединенных Штатов, сказала Мэри Линн Коффи, партнер юридической фирмы Nossaman LLP в Ирвине, штат Калифорния, которая специализируется на юридических вопросах, связанных с водно-болотными угодьями. В нем говорится, что если в районе есть гидрология водно-болотных угодий в течение определенного количества дней и растительность, связанная с влажными почвами и условиями водно-болотных угодий, то это водно-болотное угодье, и оно должно быть таким только в течение определенного периода времени из-за засушливого характера местности. наш климат, который становится все более засушливым по мере прогрессирования изменения климата .

«Эти правила изменяют это определение, — сказал Коффи. «Это больше не требует гидрологии, почв и растительности; теперь он требует гидрологии или почвы, но не того и другого, и он может быть растительным или нерастительным. Так что на самом деле есть только два теста: есть ли у него почва или гидрология, растительность или ее отсутствие? Из-за этого это гораздо более широкое определение водно-болотных угодий, чем то, которое используется в Законе о чистой воде. Это также создает большую путаницу среди консультантов в отношении того, как разграничивать эти вещи, и если это будет продолжаться, должно быть обнародовано совершенно новое руководство по разграничению.

Объем вод штата достаточно широк, чтобы включать в себя все виды искусственных или искусственных водно-болотных угодий, сказала она, и это могут быть каналы, связанные с прибрежной растительностью, перколяционные пруды, искусственные водно-болотные угодья и другие объекты, которые поощряются агентствами. на протяжении многих лет из-за их многоцелевого характера.

Бассейны для пополнения подземных вод могут стать регулируемыми

Дэниел Козад, генеральный менеджер округа водосбережения Сан-Бернардино, рассказал, как его округ отводит воду из Милл-Крик в 48 распределительных бассейнов для пополнения грунтовых вод.Эти бассейны требуют регулярного обслуживания, чтобы вода могла легко просачиваться через песчаную почву в водоносный горизонт под ними. Он опасается, что новые правила штата потребуют обширных и дорогостоящих новых разрешений каждый раз, когда потребуется техническое обслуживание бассейна. Он надеется, что государство сделает исключение для такой деятельности.

«Все эти бассейны со временем требуют определенного управления — убрать ил, изменить их контур. Для всех этих вещей потребуется какое-то неизвестное разрешение», — сказал Козад. «Мы поместили 1 миллион акров воды в землю довольно дешево и эффективно.Мы думаем, что это то, что совет штата хочет, чтобы мы делали, и то, что они хотят, чтобы делали больше людей. Поэтому нам нужно выяснить, как дать этим типам объектов возможность делать это, не приезжая и не тратя много времени на решение проблемы, которая на самом деле не является проблемой ».

Будущее с двумя наборами правил?

Фермеры обеспокоены тем, что им придется получать разрешения как от правительства штата, так и от федерального правительства, как только будут утверждены новые правила Калифорнии, сказал Фил Уильямс, генеральный юрисконсульт Westlands Water District в Центральной долине Калифорнии, крупнейшем ирригационном районе в стране.

«На карту поставлено не только значительное количество разрешительных требований и уверенность в том, что вы их выполняете, но также сложность соблюдения этих анализов и признание нашей ответственности как государственных распорядителей за обеспечение того, чтобы мы действительно их соблюдали, » он сказал.

Фермеры работают в среде почвы и воды, и Уильямс сказал, что регулирование фермеров таким образом очень похоже на регулирование работы художника, наносящего краску на холст. Но он признал, что в Центральной долине сохранение водно-болотных угодий является законной проблемой.Если или когда правила будут приняты, нам придется освоить эти правила, сказал он.

«Я думаю, что есть лучшие способы сделать это, но может наступить время, когда мы смотрим на этот мир», — сказал он. «Я хочу, чтобы мое правительство работало, и мне все равно, местное это правительство или правительство штата. Я ожидаю, что лидеры на всех уровнях будут эффективно и результативно взаимодействовать для продвижения эффективных решений».

Влияние анизотропии излучения на флуоресцентную спектроскопию и измерения расстояний FRET

Влияние ЭА на измерения интенсивности

Рассеяние флуоресцентного света частично сохраняет поляризацию излучаемого света, параллельную поляризации возбуждающего света, если ориентация диполя не теряется полностью из-за вращения диффузия в течение времени жизни возбуждения.Компоненты интенсивности флуоресценции с поляризацией, параллельной и перпендикулярной поляризации возбуждения, называются параллельной ( I ) и перпендикулярной ( I ) компонентами интенсивности (раздел 5.1.1.1 Валера (17)) . Отношение перпендикулярных/параллельных компонент интенсивности зависит только от ЭА образца: I / I = (1 − r )/(1 + 2 r ). Для изотропных образцов любая измеренная интенсивность флуоресценции I представляет собой линейную комбинацию параллельной и перпендикулярной составляющих интенсивности с коэффициентами, зависящими только от конфигурации флуорометра, а не от свойств образца: + (1 — p ) I ) W ) W ) W ,

(1)

, где W , вес, зависит от интенсивности освещения и монохроматора и эффективности детектора, а также фракцию параллельного освещения, p , зависит только от конфигурации флюорометра и может быть рассчитано как средний квадрат квадрата угла между поляризациями освещения и детектирования по профилям интенсивности освещения и детектора.Сигнал флюорометра, усредняющий по всей сфере, имеет значение p = 2 / 3 . Значения p , отличные от 1 / 3 , приводят к расхождению измеренной интенсивности с осредненной по всей сфере интенсивностью 〈 I 〉: )/〈 I 〉 = (3 p  − 1) r .

(2)

Мы рассчитали значения p для флюорометра с цилиндрически симметричными профилями освещения и светосбора.В оставшейся части этого раздела мы используем рассчитанные значения коэффициента p , чтобы найти EA на основе измерений интенсивности.

Профили освещенности и чувствительности детектора рассматриваем как тонкие конические оболочки. Если коэффициент p представляет собой билинейную сумму слагаемых, линейных по параметрам источника света, и слагаемых, линейных по параметрам детектора, с коэффициентами, зависящими от угла между источником света и детектором, то коэффициенты источника и детектора можно усреднить независимо друг от друга по произвольным цилиндрически симметричным профилям.Геометрия флюорометра описана в . Оптические оси осветительной и детекторной систем расположены в горизонтальной плоскости и пересекаются в середине камеры с образцом под углом ϕ . Предполагается, что флуориметр скорректирован на бесконечность с параллельными лучами перед коллиматором возбуждения и после коллиматора излучения. Флуорометр оснащен линейными поляризаторами возбуждения и излучения, расположенными в параллельных пучках. Предположим сначала, что монохроматоры источника света и детектора не имеют поляризационного смещения, т.е.т. е. вес w одинаков для всех ориентаций поляризатора. Монохроматоры со смещением поляризации будут рассмотрены позже. EA будет рассчитываться по четырем измерениям интенсивности: I HH , I HV , I VH и I VH , и I VV (с) или вертикальной ориентации (с) или вертикальной (с) исходного (первый индекс) и детекторного (второй индекс) поляризаторов.

Геометрия флуорометра. Параллельный пучок света от источника, расположенного на оси z , распространяется через линейный поляризатор и цилиндрически-симметричную коллиматорную оптику на малый образец, расположенный в начале системы координат.Сигнал флуоресценции от образца собирается цилиндрически-симметричной коллимирующей оптикой в ​​параллельный пучок, который проходит через линейный поляризатор в детектор. Детектор расположен в горизонтальной плоскости xz под углом ϕ с осью z . Цилиндрически-симметричная коллиматорная оптика источника и приемника света может быть охарактеризована b — и d -факторами соответственно.

Доли параллельного освещения для компонентов интенсивности рассчитываются с использованием программного обеспечения Mathematica (Wolfram Research, Champaign, IL) в зависимости от углов поляризатора источника (S) и детектора (D), ψ S и ψ D , соответственно, считается из горизонтальной плоскости (ψ = 0):

p S , ψ d ) = ⅙ [2 + D S D D + 3 B S B B D (COS (2ψ S ) COS (2ψ D ) + Cosφsin (2ψ S ) SIN (2ψ D )) + ( P 2 (COS Φ) — 1) ( D S + B S COS (2ψ S ) ( D D + B D COS (2ψ D ))], 

(3)

, где множители d = 〈 P 2 (cos α )〉 и b = 〈9 900 090 (α/2)〉 усредняются по соответствующим профилям освещения (индекс S) или светосбора (индекс D) с весами, пропорциональными нормализованной интенсивности света, α — угол конуса между направлением луча в камере с образцом и ось, P 2 ( x ) ≡ ½(3 x 2  − 1) — второй полином Лежандра.Коэффициенты b — и d равны 1 для коллиматоров с малой числовой апертурой (ЧА), что может вызывать поляризацию измеряемого сигнала ( p  ≠ ⅓). Более высокие значения NA приводят к меньшим b — и d -факторам, что вызывает деполяризацию ( p ≅ ⅓). Значения коэффициентов d — и b для типичных оптических конфигураций рассчитаны ниже. Доли параллельного освещения для четырех ортогональных ориентаций поляризатора составляют p HH = p (0, 0), pHV=p(0,π2), pVH=p(π2,0) и pVV=p( π2, π2).Если для измерения интенсивности не используется поляризатор, p=〈p(ψS,ψD)〉ψS,ψD=13+16P2(cosϕ)dSdD и погрешность измерения интенсивности составляет

δ = ½ r P 2 (cos ϕ) d S d D .

(4)

Мы заметили, что этот результат может быть получен непосредственно из теоремы Солейе (17–19), если d -факторов рассматривать как «коэффициенты деполяризации» для источника света и детектора.

EA флуоресцентного образца можно рассчитать по четырем измерениям интенсивности по уравнению. 3 AS

R≡I‖-I⊥i‖ + 2i⊥ = A1-A12-4 (ℑ2-1) A22A2,

(5)

где

2 ≡ ( I VV I I HH ) / ( I VH I HV ),

(6)

A 1 = (3 P VV — 1 ) + (3 P HH — 1) — 2 [(3 P VH — 1) + (3 P HV — 1)],

(7 )

A 2 = ℑ = 2 (3 P VH — 1) (3 P HV — 1) — (3 P VV — 1) (3 p HH  − 1).

(8)

Для лазерного гелевого сканера или микроскопа с ϕ = 0° или 180° достаточно только двух измерений интенсивности (поскольку I VV I HH и 1 2 VH и I = I HV ), и уравнение. 5 можно упростить как

R = 2 / [3 B S B D ( + 1) / ( — 1) — D S d D ],

(9)

где = I VV / I HV .Уравнение 9 полезно, и EA можно измерить, если только b S b D = 0,

Теперь мы принимаем во внимание, что эффективность дифракционных решеток, используемых в флуорометрических монохроматорах, может изменяться на порядок в зависимости от изменение длины волны и поляризации. Эффективность источника света или детектора монохроматоров (с вертикальными или горизонтальными прорезями) для вертикальных или горизонтальных поляризаций E SV , E SH , E DV , E DH , соответственно; они являются функциями длины волны.Весовой коэффициент в уравнении. 1 зависит от эффективности и ориентации поляризаторов как

W S , ψ D ) = ( E SH COS 2 ψ S + E SV SIN 2 ψ S ) ( E DH COS 2 ψ D + E DV SIN 2 ψ D ).

(10)

Долю параллельной составляющей интенсивности для неполяризованного измерения можно вычислить аналитически с помощью компьютера для произвольных цилиндрически-симметричных профилей освещения и детектирования, но нам не удалось упростить громоздкий результат до краткой формы.В пределе малых числовых апертур осветительной и детекторной оптики коэффициенты b — и d приближаются к 1 снизу, а доля параллельного освещения составляет

p = ( g G + COS 2 φ) / (1 + г + г + г г ),

9 г
),

(11)

, где факторы г E DV / E DH и г и г E SV / E / E / E / E / E / E / E / E / E / E SH могут быть рассчитаны из четырех поляризованных измерений интенсивности как

g = (12sin2φ + (12sin2φ) 2 + ℑ2cos2φ) (IHV / IHH ),

(12)

g=(12sin2ϕ+(12sin2ϕ)2+ℑ2cos2ϕ)(IVH/IHH).

(13)

Коэффициент g является функцией длины волны источника света, описывающей смещение поляризации источника света. Его определение простое, но мы не можем найти его в литературе, поэтому мы ввели его по аналогии с G -фактором, который является функцией длины волны излучения, описывающей смещение поляризации детектора. Если ϕ = 90 o , скобки в уравнениях. 12 и 13 равны 1, а уравнение. 12 принимает общую форму G = I HV / I HH .

Пример: b- и d-факторы для типичных аппаратных конфигураций

Если параллельный линейно поляризованный лазерный луч перекрывает коллиматорную линзу источника света с одинаковой интенсивностью, его d — и b -факторы равны

dS=P2 ((1−x−2)ln(1−x2)),bS=54−x−2(1−1−x2)+14(1−x−2)ln(1−x2),

(14 )

, где x = NA/ n  – отношение числовой апертуры объектива к показателю преломления среды. Если объектив имеет 100% эффективность сбора света для всех углов апертуры, его d — и b -факторы равны ()

dD=(1−x2+1−x2)/2,bD=(2+ 1−x2−x2/4)/3.

(15)

EA изотропного образца можно измерить с помощью микроскопа с флуоресцентным освещением полного внутреннего отражения через призму с линейно поляризованным лазерным лучом. EA можно рассчитать с помощью уравнения. 9, если известны b — и d -факторы, то поляризация освещения фиксируется, а линейным поляризатором в канале наблюдения изменяется только поляризация излучения. Существуют две поляризации лазерного луча, создающего затухающую волну: s-поляризованная с электрическим полем падающего света и затухающей волны, параллельная границе раздела двух сред, и р-поляризованная с электрическим полем в плоскости падающего света. и отраженные лучи.Отношение компонент поляризации, перпендикулярных и параллельных границе раздела сред, для р-поляризованной затухающей волны составляет и стекло, а θ — угол падения (уравнения 5 и 6 Аксельрода (20)). Для P-поляризации B — и D — и D — и D S = 1 и S = 1 и b S = — N 2 / (2Sin 2 θ — n 2 ).Для s-поляризованного освещения деполяризация отсутствует, и d S = b S = 1. d — и b -факторы детектора рассчитаны выше для объектива микроскопа ( уравнение 15). Результаты могут быть обобщены для наблюдения одиночной молекулы.

Коэффициенты b — и d в зависимости от NA/ n для лазерного освещения, переполняющего конденсорную линзу с одинаковой интенсивностью, и для объектива, собирающего флуоресцентный свет с одинаковой эффективностью для всех телесных углов в пределах его апертуры , рассчитанный с использованием уравнений.14 и 15.

Мы описываем гель-лазерный сканер Typhoon Trio компании GE Healthcare (Waukesha, WI) в качестве примера реального аппаратного оборудования. По данным технической поддержки компании, в лазерных сканерах серии Typhoon используются два объектива с фокусным расстоянием 6 мм (установка: валик) и 9 мм (установка: +3 мм), оба с числовой апертурой = 0,7. Для освещения и детектирования используется один и тот же объектив, но диаметр луча освещения 0,7 мм намного меньше апертуры объектива, а апертура NA объектива применима только для детектирования.Влияние освещенности Na можно пренебрегать: N A S ≅ 0, B S = D S = 1. B — и D -Forctors для детектор можно рассчитать по уравнению 15: b D = 0,86, d D = 0,61. В лазерном сканере Typhoon в качестве детектора используются фиксированные фильтры и трубка фотоумножителя, и предполагается, что он не имеет смещения поляризации или длины волны. Используя уравнение4 мы вычисляем ошибку неполяризованной интенсивности как функцию EA образца: δ = 0,31 r . Если EA образца неизвестен (-0,2 ≤ r ≤ 0,4), возможная ошибка интенсивности составляет от -6% до +12%.

Оценка FRET DOF из EA

Безызлучательный перенос энергии возбуждения между флуорофорами или от флуорофора к тушителю в классической электродинамике можно описать как ближнепольное диполь-дипольное взаимодействие. Здесь мы предполагаем, что донорный и акцепторный красители представляют собой два простых диполя.Более сложные случаи можно рассматривать как комбинацию нескольких диполей (21), но это выходит за рамки данной статьи. Мы описываем геометрию FRET-пары полярными углами для донора θ d и акцептора θ a , отсчитываемыми от оси, соединяющей донор и акцептор, и двугранным углом между плоскостями диполя, ϕ da (). Угол между донором и акцептором β DA может быть рассчитан как функция других углов

COSβ DA = Cosθ A COSθ D + SINOθ A SINOθ D COSφ DU ..

Из уравнения. 16, и из того факта, что −1 ≤ cosϕ da ≤ 1, легко вывести тривиальное, но важное геометрическое неравенство, отсутствующее в работе Dale et al. (7):

cos(θ d + θ a ) ≤ cosβ da ≤ ≤ cos(θ d  − θ a ).

(17)

Если известно значение cosβ da , то можно использовать неравенство 17 как ограничение на допустимую площадь полярных углов.

Согласно теории Фёрстера (глава 9 Лаковича (17)), скорость передачи энергии пропорциональна степени свободы, κ 2 = (3cosθ a cosθ d −cosβ da

) 2 9 .Радиус Фёрстера, R 0 , определяется как расстояние, на котором эффективность FRET составляет 50% для данного значения DOF; таким образом, он пропорционален κ26 (7,17). Расстояние между флуорофорами можно рассчитать по эффективности FRET, E и R 0 как R=R0E-1-16∝κ26. Среднее значение телесного угла степени свободы равно 2 / 3 . Ориентационное усреднение κ 2 справедливо только в том случае, если ориентации донорного и акцепторного диполей изотропно перераспределяются по всей сфере в течение времени жизни возбуждения донора (т.т. е. нет истощения населения для штатов с более высокими значениями степени свободы по сравнению с выжившими штатами с меньшей глубиной свободы). Расхождение в измерениях расстояний из-за значений ГРИП, отличных от усредненного значения по углу, можно описать поправочным коэффициентом Δ≡κ2/236, равным отношению истинного расстояния к кажущемуся расстоянию, рассчитанному для κ 2 = ⅔ . Ниже мы оцениваем диапазон поправочного коэффициента по измерениям ЭА.

Будем считать, что донорный и акцепторный флуорофоры присоединены к большой и неподвижной (в течение времени возбуждения) макромолекуле; флуорофоры диффундируют только под углом по отношению ко всей макромолекуле, а расстояние между донором и акцептором фиксировано.Согласно теореме Солейе, EA сигнала FRET является произведением предельной анизотропии ⅖, факторов аксиальной деполяризации донора и акцептора ddxd и daxd и фактора деполяризации P 2 (cosβ da ), что соответствует угол между центрами осей симметрии распределения доноров и акцепторов, β da (7):

rFRET=25ddxddaxaP2(cosβda).

(18)

Мы можем рассчитать ddxd из EA, rd=25dd=25(ddxd)2, для донорного флуорофора, присоединенного к макромолекуле в отсутствие акцепторного флуорофора:

, где d d фактор деполяризации только для донора, который равен квадрату фактора аксиальной деполяризации, ddxd.Фактор осевой деполяризации акцептора, daxa, можно рассчитать аналогичным образом. (Если акцептор не флуорофор, а темновой гаситель, его коэффициент аксиальной деполяризации не может быть получен из измеренного EA. Эту проблему можно решить, если акцептор не является простым диполем и может быть почти изотропным по своей сути.) Знак ddxd может быть отрицательным, если r d ≤ 0,1 для вращающейся связи или r d ≤ 1/160 для заполненных конусов угловых распределений донорного диполя относительно макромолекулы (7).Отрицательный знак факторов деполяризации может привести к двум или даже четырем различным возможностям для степени свободы, но нетрудно рассмотреть их все с помощью компьютера. Как правило, следует выбирать самый широкий диапазон для оценки погрешности.

Мы можем рассчитать cosβ da из FRET-поляризации, используя уравнение. 18:

cosβda=13+53rFRETddxddaxa.

(20)

Знак cosβ da не определен, но можно считать cosβ da всегда положительным и 0 o ≤ β da ≤ 90 dipoleo в уравнениях, описывающих диполео связи, так как радиационные дипольные моменты (в отличие от ориентации флуоресцентных молекул) определяются не векторами, а проективными векторами, т.е.т. е. противоположные ориентации эквивалентны. По тем же соображениям мы можем ограничить 0° ≤ θ d ≤ 90° и 0° ≤ θ a ≤ 90°, если это необходимо. Угол между донором и акцептором, β da , является единственным углом, который можно найти из измерений ЭА или любых других измерений поляризации над изотропными образцами. Измерения других углов, влияющих на DOF, требуют некоторых дополнительных знаний о макромолекуле, ее точках прикрепления флуорофора и ее конформационной динамике, и такие знания трудно получить экспериментально (1).

Степень свободы, усредненная по цилиндрически симметричным распределениям акцептора и донора, была получена Dale et al. (7):

κ2=ddxddaxaκ02+(1−daxa)(ddxdcos2θd+13)+(1−ddxd)(daxacos2θa+13),

(21)

, где

(22)

Степень свободы в уравнении. 21 зависит только от двух неизвестных углов, θ d и θ a , ограниченных ограничением 17; cosβ da можно найти из уравнения. 20. Минимумы и максимумы степени свободы из уравнения.21 были рассчитаны неправильно в Dale et al. (7) независимо от использования ограничения 17 (это можно проверить численно). Возможный диапазон глубины резкости можно найти с помощью компьютера.

Если EA сигнала FRET неизвестен или если уравнение 18 не может быть решен для β da с хорошей точностью, минимальное и максимальное значения ГРИП с положительными коэффициентами деполяризации (7) равны

κmin2=23(1−(52rd+52ra)/2),κmax2=23 (1+52р+52ра+352р52ра).

(23)

Если возможны отрицательные факторы деполяризации (см.19 и последующее обсуждение), минимальное и максимальное значения степени свободы можно найти с помощью компьютера, перепробовав все комбинации знаков в уравнении. 21 ().

Минимальное и максимальное значения степени свободы ( A ) и поправочного коэффициента расстояния ( B ) в зависимости от EA, если донор и акцептор имеют одинаковое значение EA: r d = r a = r . График рассчитывается с использованием уравнения. 23 для положительного ( сплошная линия ) и отрицательного ( пунктирная линия (возможно только для r  ≤ 0.1)) факторы аксиальной деполяризации. Легко видеть, что диапазон для степени свободы медленно сходится к ⅔ при r d, a → 0. Типичный диапазон EA, 0,15–0,25, соответствует −15 + 20% или даже −20 + 25 %, погрешность измерения расстояния FRET.

Пример: неопределенность степени свободы для комплекса интегразы ВИЧ-1

Комплекс интегразы ВИЧ-1 состоит из четырех молекул интегразы и двух двухцепочечных фрагментов ДНК (22). Фрагменты ДНК в комплексе могут быть двумя концами одной длинной молекулы ДНК, как в случае настоящей ДНК ВИЧ-1, или могут иметь форму двух более коротких фрагментов ДНК.Комплекс трудно очистить in vitro, но его можно отделить от непрореагировавшего субстрата с помощью нативного гель-электрофореза. Атомно-силовые микроскопические изображения комплексов не содержат информации с достаточно высоким разрешением, а также страдают от возможных деформаций комплексов во время поверхностной иммобилизации, необходимой для атомно-силовой микроскопии. В качестве примера мы используем измерение расстояния FRET на комплексе интегразы ВИЧ-1 с хвостами ДНК, помеченными красителями Cy3 и Cy5 вблизи концов.

Мы выделяем правильно собранный комплекс из непрореагировавшего субстрата с помощью электрофореза в нативном агарозном геле.Соответствующую полосу на геле идентифицировали и измеряли с помощью лазерного сканера геля с длинами волн возбуждения донора и акцептора в донорном, акцепторном и FRET-канале. Для флуорометрических измерений вырезали кусочки геля, содержащие интересующую полосу, и помещали в кювету с буфером или смесью глицерин-буфер. Нашей целью было оценить расстояния между различными точками ДНК внутри комплекса. Результаты по структуре комплекса ВИЧ-1 будут опубликованы в отдельной статье.Мы не обсуждаем здесь какие-либо конструктивные детали комплекса.

EA сигналов донора, акцептора и FRET были измерены для расчета неопределенности расстояния из-за DOF. Результаты измерений EA для двух конфигураций пар FRET суммированы в . Диапазон глубины резкости и неопределенность расстояния рассчитывались для двух пар позиций маркировки. Первые две строки таблицы соответствуют паре FRET в позиции маркировки 1-1′, представляя случаи неизвестного и известного EA сигнала FRET.Последняя строка соответствует положению 2-2′ пары FRET с более высокими значениями EA донора и акцептора и известной EA FRET. Если FRET EA известен, угол между донором и акцептором, β da , рассчитывали по уравнению. 20. Для положения 1-1′ с известным FRET EA допустимый диапазон полярных углов θ d и θ a из неравенства 17 вычерчен в ; поправочные коэффициенты ориентации диполя и расстояния, рассчитанные с использованием уравнений 20–22 представлены в зависимости от полярных углов в пределах их допустимой площади.Если FRET EA неизвестен, диапазоны глубины резкости и расстояния рассчитываются по уравнению. 23. Диапазоны глубины резкости и расстояния нанесены графически для случая r d = r a .

Допустимая площадь на плоскости полярного угла (θ d , θ a ) ( черный прямоугольник ; симметричный θ d ↔ θ a ) имеет выполненное неравенство 17. Для расчета этой площади мы используем r d = 0,275, r a = 0.292 и r FRET = -0,026. Поскольку радиационные дипольные моменты являются проективными векторами, достаточно рассмотреть только четверть симметричной допустимой площади с 0≤θd≤π2 и 0≤θa≤π2.

Графики DOFS ( A ) и коэффициент коррекции расстояния, δ ( B ) для R D = 0,275, R A = 0,292 и R FRET = −0,026 в зависимости от θ a  − θ d и θ a + θ d на допустимом участке от .Графики рассчитаны с использованием уравнений 20–22.

Таблица 1

DOF Диапазон и неопределенности расстояния

7 0 R D R D A 0 A 0 R FRET 0 0 0 DA κ 2 Range R Неопределенность 1-1 ‘ 0.275 0.292 — — 0.11-3.21 -26 + 30% 1-1 ‘ 0.275 0.292 -0.026 58.6 ° 0.15-2.50 -22 + 25% 2- 2 ‘ 0.340 0.316 0.230 0.230 25.1 ° 0.11-3.33 -26 + 31%

Уравнение 4 описывает систематическую ошибку в интенсивности флуоресценции, измеренной лазерным гелем-сканером из-за советник выборки.В лазерном сканере могут отсутствовать поляризаторы, но ЭА можно измерить с помощью объемного флуорометра. Коррекция интенсивности для лазерного сканера Typhoon обсуждалась выше.

Обучение игре на грифе — Мир уроков игры на гитаре


Обучение игре на грифе — это сложная задача, с которой этот урок поможет вам эффективно справиться. Знаете ли вы, что гитара с 22 ладами содержит 138 нот? Это огромная задача, которая бросает вызов как начинающим, так и опытным гитаристам. Этот урок расскажет вам, почему некоторые люди учат этому неправильно (неэффективно и скучно).

Почему вы должны изучать гриф

Вы должны изучить гриф по одной простой причине. Вы хотите играть быстрее!

Обычно, когда люди говорят о скорости, они имеют в виду физические  аспекты обучения игре на гитаре. Обычно я думаю о том, как шредеры выстукивали пальцами свой путь к безумному шквалу нот. Измельчение требует много практики, но это другой тип скорости.

Когда вы изучаете гриф, вы играете быстрее, потому что можете мгновенно вспомнить ноту.Мгновенный вызов позволяет найти и воспроизвести любую ноту как можно быстрее. Это умственная  скорость, которая позволяет вам решать, находить и играть быстрее.

Почему создание грифа не работает

Большинство гитаристов утверждают, что знают гриф, потому что могут найти любую ноту. Многие песни имеют темп 120 ударов в минуту, что составляет 2 секунды на такт.

  • Вся нота = 2 секунды
  • Половина ноты = 1 секунда
  • Четвертная нота = 1/2 секунды
  • Восьмая = 1/4 секунды
  • Шестнадцатая нота = 1/8 секунды

Вам нужно запоминать ноты за доли секунды! Вот почему знание того, как найти любую заметку, не работает.Без мгновенного отзыва вы не сможете идти в ногу!

Как научиться играть на грифе

Научиться играть на грифе не сложно, но это требует практики. Большинству гитаристов эта задача кажется скучной, потому что они изучают ее неправильно. Кроме того, они пытаются использовать ярлыки, которые не работают! Лучший способ выучить гриф — использовать несколько способов запоминания ноты. Это не только интереснее, но и эффективнее.

Использовать ассоциации

Человеческий мозг запоминает с помощью ассоциаций.Когда вы играете ноту, вы думаете о той ноте, которую хотите. Вы найдете его на грифе. Вы слышите записку. Вы видите гриф. Все эти элементы могут быть связаны друг с другом для формирования многомерных упражнений. Позже я дам вам упражнения, которые связывают то, что вы видите, слышите и чувствуете, чтобы максимизировать вашу эффективность.

Тренируйтесь, чтобы запомнить

Случалось ли вам когда-нибудь зубрить перед экзаменом и забывать то, что выучили? Когда вы попытаетесь выучить гриф, вы забудете об этом. Ваш мозг переводит вашу кратковременную память в долговременную, когда вы спите.Я рекомендую тренироваться на грифе по 10-20 минут в день, пока вы не освоите его.

Избегайте этих методов

Вот список неэффективных или скучных способов изучения грифа. Это мой антирекомендационный список.

  • Не пытайтесь зрительно запомнить изображение нот на грифе. Это, наверное, самый скучный метод, и вы не ассоциируете звук
  • .
  • Не пытайтесь срезать путь, изучая только лады с 1 по 12. Лады 13+ расположены ближе друг к другу, поэтому они воспринимаются по-другому и имеют более высокий тон.Мгновенный отзыв требует психических и физических отзывов!
  • Не ограничивайтесь 5-й -й и 6-й -й. Многие гитаристы изучают эти две струны и выводят остальные ноты. Это просто недостаточно быстро.
  • Не репетируйте слишком много нот за один раз. Большинство людей могут запомнить около 7 предметов за один присест без особых усилий. По иронии судьбы существует семь естественных названий нот (A, B, C, D, E, F, G). Я рекомендую заняться ими в первую очередь.

Что нужно знать перед началом занятий

В этом разделе я дам вам необходимую информацию.

Нумерация струн и стандартная настройка

Струны нумеруются от самой тонкой струны (1-я струна) до самой толстой (6-я струна). Строй дается от 6-й струны к 1-й струне: E-A-D-G-B-E. Этот строй (E-A-D-G-B-E) называется стандартным строем.

Ноты названы с использованием первых семи букв алфавита, однако на гитаре воспроизводится более семи звуков или нот.Названия нот или буквы повторяются. Например: имя примечания
после G равно A: … E-F-G-A-B-C-D-E-F-G-A-B-C …

Нумерация ладов

Лады пронумерованы от головки грифа к корпусу, начиная с 1. Иногда цифра 0 или буква O используются для обозначения открытой струны или струны, по которой играют без ладов.

Ладирование ноты выполняется нажатием струны вниз за ладом (со стороны грифа грифа).

Механизм грифа

Гитаристы могут перемещаться горизонтально вверх или вниз по грифу или вертикально по грифу.Это общие термины, используемые для обозначения того, как нужно менять положение рук при игре на гитаре.

Расположение нот на грифе

В этом разделе показано, где можно сыграть каждую ноту на гитаре. Обозначения даны для полноты. У меня есть урок по чтению стандартной нотации и табулатуры, если вам нужна дополнительная информация.

Ноты первой струны (высокая струна ми)

Ноты 2-й струны (струна B)

Ноты 3-й струны (струна G)


Ноты 4-й струны (струна ре)

5-я струна (струна А)

6-я струна (ми струна)

Обозначение всех примечаний

Следующие обозначения и табулатура показывают полный диапазон гитары в стандартной настройке.

Некоторые заметки можно воспроизвести только в 1 месте, а другие можно воспроизвести до 5 мест.

Упражнения по возрастанию и спуску

Это простые упражнения, но вы хотите попробовать несколько вещей, играя в них.

  • Прячьте табулатуру во время игры. Показывайте только обозначения (чтобы вас не обманули).
  • Не используйте один палец для всех нот. Найдите наименьшее возможное количество ручных переключений.
  • Вы заметите, что я использовал четвертные ноты для B-C и E-F.Это полутона друг от друга. Я использовал половинные ноты, когда интервал составляет целый шаг (2 полутона). Это должно усилить различные интервалы.
  • Произносите ноты во время игры, чтобы связать название с нотой.
  • Следите за своей беспокойной рукой, когда говорите, и играйте по нотам.
  • Прослушайте записи. Постарайтесь запомнить их звук вместе с ощущением раздражения в этом положении.
  • Попробуйте послушать с закрытыми глазами и с глазами на ладах.
  • Обратите внимание, как точки на грифе соответствуют каждой ноте.
  • Используйте метроном со скоростью 60 ударов в минуту (1 секунда на удар). Увеличивайте скорость интервалами по 20 ударов в минуту каждый раз, когда вы проходите его. Посмотрите, как быстро вы можете играть чисто. Идите медленнее, если вы становитесь неряшливым, чтобы не формировать плохие привычки.

Ноты 6-й струны по возрастанию

Я рекомендую переместить руку с открытой/первой позиции на 5-ю, 10-ю, 15-ю и 19-ю позиции. Не стесняйтесь попробовать другие ручные переключения, чтобы изменить его.

Ноты 6-й струны по убыванию

Еще раз попробуйте разные места ручного переключения передач.

Мажорные аккорды на шестой струне

 

Ноты 5-й струны по возрастанию

Ноты 5-й струны по убыванию

Мажорные аккорды 5-й струны по возрастанию

Сыграйте эти аккорды по возрастанию, а затем по убыванию.

Другие упражнения на подъем и спуск

Я оставлю это на ваше усмотрение, что само по себе является отличным умственным упражнением.

  • Вы заметите, что я использовал мажорные аккорды в форме ми и ля.Попробуйте сыграть последовательность диатонических аккордов в тональности C: CMaj, Dm, Em, FMaj, GMaj, Am, Bdim. Например, замените EMaj на Em. Хотя диатоническая гармония является отдельной темой, в этих упражнениях я определяю ее как аккорды, в которых используются ноты мажорной гаммы. В данном случае гамма до мажор.
  • Замените аккорды на диатонические септаккорды в тональности C из форм E и A: CM7, Dm7, Em7, FM7, G7, Am7, Bm7b5.
  • Поскольку аккорды строятся на терциях (мажорные и минорные терции), попробуйте играть в терциях (каждая вторая нота на струне), чтобы вы знали ноты аккорда вдоль струны.Это работает для всех диатонических аккордов в тональности. Возьмем для примера ми минор 7: E-(пропустить F)-G-(пропустить A)-B-(пропустить C)-D. Ноты Em7: E G B D. Если вы хотите Em, пропустите последнюю ноту. Я люблю это упражнение. Он учит одновременно стольким нюансам музыки.

Дополнительные упражнения

Вот лишь несколько дополнительных упражнений, которые вы можете использовать.

  • Сыграйте ноту, затем сыграйте ее октаву на той же струне (12 ладов вверх). Повторите это для всех нот.
  • Сыграйте ноту, затем сыграйте ту же ноту на соседней струне.Пример. А на 5-й струне, открытая; А на 6-й струне, 5-й лад.
  • Сыграйте ноту, затем сыграйте ее октаву на соседней струне. Пример E на 6-й струне, открытый; Ми на 5-й струне, 7-й лад.
  • Сыграйте ноту, затем сыграйте ее октаву через две струны. Пример: ми на 6-й струне, открытая; Ми на 4-й струне, 2-й лад. Обратите внимание, как эти октавы используются в известных вам формах аккордов.
  • Сыграйте аккорд и определите основные ноты в этом аккорде.

Упражнений намного больше, поэтому я предлагаю вам книгу, чтобы систематизировать все это, чтобы вы могли быстро сосредоточиться на изучении грифа! Он содержит 159 упражнений, которые сделают ваши тренировки свежими.Он включает в себя теорию музыки, аккорды и многое другое, так что вы изучаете несколько концепций одновременно. Я до сих пор использую эти упражнения, чтобы оставаться свежим. Они работают от новичков до профессионалов. Подумайте о покупке моей книги «Секреты изучения грифа »!

Последние мысли

Надеюсь, вам понравился урок по игре на грифе. Это требует много практики, но сохранение мотивации кажется проблемой №1. Есть много интересных способов попрактиковаться на гитаре. Лучший способ — освежить свою практику разнообразными упражнениями.Как только вы это сделаете, вы вырветесь из колеи и получите гораздо больше удовольствия от игры на гитаре!

Если этот урок помог вам, пожалуйста, отметьте мою новую страницу в Facebook и напишите о том, как она вам помогла.

Разработка генетически кодируемой системы FRET с использованием флуоресцентных РНК-аптамеров

Синтез YO3-ацетата

Et 3 N (0,26  мл, 1,86  ммоль, 1 экв.) добавляли к перемешиваемому раствору 4-[( E 9) -2-(ацетилфениламино)этенил]-1-метилхинолиния иодид 28 (790 мг, 1.84 ммоль, 1 экв.) и 2-(2-метилбенз[ d ]оксазол-3-ийм-3-ил)ацетат 42 (500 мг, 2,62 ммоль, 1,42 экв.) в ДХМ. Раствор оставляли для перемешивания на 20 часов с последующим концентрированием в вакууме. Затем твердое вещество ресуспендировали в ДХМ (150 мл), фильтровали и промывали ацетоном (3×10 мл). Твердое вещество сушили в вакууме с получением (85 мг, 12%) ацетата YO3 в виде аморфного твердого вещества пурпурного цвета. 1 H ЯМР (400  МГц, ДМСО- D6 ) δ 10,17 (с, 1H), 8,47–8,38 (м, 2H), 8,34–8,28 (м, 1H), 8.24–8,18 (м, 1H), 8,18–8,13 (м, 1H), 7,94–7,87 (м, 2H), 7,68–7,59 (м, 3H), 7,52–7,46 (м, 1H), 7,41–7,28 (м , 3H), 7,01–6,94 (м, 1H), 5,91–5,82 (м, 1H), 4,47 (с, 2H), 4,05 (с, 3H). HRMS (ESI) [M + , C 22 H 19 N 2 O 3 + ] Требуется м / Z 359.1390, найдено 359.1395.

YO3 PEG 3 link амин синтез биотина

HBTU (45 мг, 3 экв.) и DIPEA (30 экв.) добавляли к YO3-ацетату (3 мг, 1 экв.) в ДМФ (250 мкл).Раствору давали возможность перемешиваться в течение 10 минут, после чего добавляли N -биотинил-3,6,9-триоксаундекан-1,11-диамин 43 (7 мг, 2 экв.) и раствор перемешивали в течение 18 часов. . Растворитель лиофилизировали и остаток повторно растворяли в смеси MeCN/50  мМ 1:1 NH 4 OAc (водн.) . Затем раствор очищали с помощью ОФ-ВЭЖХ (25–50% MeCN против 50 мМ NH 4 OAc в течение 30 мин). ОФ-ВЭЖХ Rt = 14,9 мин. HRMS (ESI) [M + ,C 40 H 51 N 6 O 7 S + ] требуется м / 7 z 3534, найдено 759,3531.

Моделирование структурной РНК

Трехмерный (3D) дизайн базовой структуры оригами РНК 2H-AE подробно описан ранее 24, 44 . Вкратце, с помощью программ 3D-моделирования Swiss-PdbViewer 45 и UCSF Chimera 46 две стандартные двойные спирали РНК А-формы были выровнены параллельно и повернуты для создания оптимального расстояния для антипараллельного четного (AE) двойного кроссинговера (DX). ). Внутренняя 180-градусная петля целования (HIV-1 DIS, PDB id: 2B8R) располагалась между кроссоверами, а тетрапетли UUCG (извлеченные из PDB id: 1F7Y) располагались на концах двойных спиралей.Трехмерный дизайн конструкций apta-FRET был основан на структуре оригами РНК 2H-AE. Минимальное ядро ​​аптамера шпината (идентификатор PDB: 4Q9R), ранее использовавшегося для создания Bunch of Baby Spinach 47 , располагалось на одном из внешних доменов двойной спирали, граничащих с DX. Мотив шпината был повернут, чтобы направить дипольный момент DFHBI-1T либо прямо к соседнему параллельно выровненному домену двойной спирали, где должен был располагаться аптамер манго, либо от него. Ядро в исходном аптамере шпината окружено двумя доменами двойной спирали, называемыми P1.2 и P2.1 Хуанга и др. 31 Это позволяет использовать два различных варианта включения; «нормальная» версия, в которой домен P1.2 использовался для соединения шпината с РНК-оригами, и «перевернутая» версия (отмечена *), где домен P2.1 использовался для соединения шпината с РНК-оригами. Стебель-петля, построенная из стандартной двойной спирали А-формы и тетрапетли UUCG, была прикреплена к другому концу ядра шпината. Из-за стерических столкновений жизнеспособными оказались только две из четырех возможных версий; нормальная версия с диполем, направленным в сторону соседней двойной спирали, и перевернутая версия, в которой диполь направлен в сторону от соседней двойной спирали.Недавно опубликованная сокристаллическая структура аптамера манго выявила трехуровневый G-квадруплекс, соединенный с доменом двойной спирали через мотив, подобный тетрапетле GAAA, и не позволяет «переворачивать» манго, как шпинат. Связь между тетрапетлей и G-квадруплексом структурно не определена и ожидается, что она будет гибкой, и TO3-биотин (очень похожий на YO3-биотин) не может быть смоделирован в связывающем кармане без стерических столкновений. Поэтому мы не смогли смоделировать точное положение диполя флуорофора YO3-биотин.Чтобы найти оптимальное положение Mango, длина домена двойной спирали между Mango и ближайшим DX варьировалась с шагом в две пары оснований. В некоторых позициях были обнаружены стерические коллизии. После начального моделирования 3D-структуры были сопоставлены с помощью скрипта Perl («ligate.pl», доступного на нашей веб-странице www.andersen-lab.dk) и уточнены с использованием функции рекурсивного геометрического уточнения в Assemble2 48 . 3D-модели в этой работе были визуализированы в UCSF Chimera.

Расчет дипольного момента

Дипольный момент DFHBI-1T рассчитывался с использованием пакета программ Marvin (версия 15.10.19) и подключаемый модуль калькулятора, разработанный ChemAxon (http://www.chemaxon.com/). Химическая структура DFHBI-1T была нарисована в MarvinSketch, а состояние протонирования молекулы определено при pH 7,8 с использованием подключаемого модуля pKa Calculator. Дипольный момент наиболее распространенных микровидов DFHBI-1T (70,4% при pH 7,8) был рассчитан с использованием плагина Dipole Moment Calculator. Полный дипольный момент DFHBI-1T визуализировали как вектор, выраженный в системе координат главной оси. Полученный файл с указанием как химической структуры, так и вектора дипольного момента DFHBI-1T был экспортирован в виде файла pdb и импортирован в Swiss-PdbViewer 45 для сопоставления молекулы флуорофора с трехмерными координатами DFHBI из кристаллической структуры шпината (идентификатор PDB : 4Q9R).

Дизайн последовательности РНК

Процесс проектирования последовательности подробно описан ранее 24, 44 . Вкратце, 3D-модели были загружены в Assemble2 48 для визуализации вторичной структуры, которые были вручную переведены в текстовые файлы проектирования 2D-структуры. Для apta-FRET с разветвленным KL мотив Т-образного соединения был создан в 2D-чертеже путем замены двух выпуклых аденинов в одном из партнеров петли поцелуя на стебель-петлю. Последовательность консервативных мотивов РНК (KL, тетрапетли, шпинат, манго, РНК-захватчик) сохраняли, а оставшуюся последовательность обозначали Ns.Каждая последовательность была дополнительно сужена путем «запирания» кроссоверов с парами оснований G-C, включения пары GU вобуляции на каждые восемь непрерывных пар оснований и ограничения 5′-конца 5′-GGGAGA-3′, оптимальной последовательности инициации для T7. РНК-полимераза. 2D-чертежи были прочитаны с помощью скрипта Perl («trace.pl», доступного на нашей веб-странице www.andersen-lab.dk), который выводит нотацию с точками и ограничения последовательности, подходящие для проектирования последовательности в NUPACK 49 . . Последовательности, разработанные в NUPACK, складывали и оценивали с помощью mFold 50 .

Синтез ДНК-матриц

ДНК-матрицы конструкций apta-FRET получали путем стандартной ПЦР-амплификации фрагментов гена gBlocks из IDT с использованием ДНК-полимеразы Phusion High-Fidelity (ThermoFischer Scientific). Амплификацию проводили в 1× буфере Phusion HF (предоставляется производителем), 200 мкМ dNTP (invitrogen), 1 мкМ прямого (Fwd) и обратного (Rev) праймеров (заказаны в IDT), 4 нг gBlock и 1 ед. полимеразы Phusion. Матрицы ДНК простых аптамеров получали стандартной ПЦР-амплификации ультрамеров ДНК (IDT) с использованием ДНК-полимеразы Taq (Invitrogen).Амплификацию проводили в 1× буфере Taq , 200 мкМ dNTP (invitrogen), 1,5 мМ MgCl 2 , 1 мкМ праймеров Fwd и Rev, 4 нг ультрамера и 2,5 ед. Taq ДНК-полимеразы. Для каждой матрицы были разработаны праймеры Fwd и Rev (см. Дополнительное примечание 2), а температуры отжига были рассчитаны с использованием калькулятора New England Biolabs (NEBs) T m (http://tmcalculator.neb.com/). Амплифицированную ДНК очищали с использованием набора для очистки ДНК GFX PCR (иллюстрация) и хранили в буфере TE.

Транскрипция и очистка РНК in vitro

Транскрипция in vitro выполнялась путем смешивания матрицы ДНК и буфера для транскрипции (15 мМ Mg(OAc) 2 , 50 мМ трис-ацетат pH 7,8, 40 мМ NaCl, 0,1% Tween20) , 1 мМ ДТТ и НТФ (по 2,5 мМ каждого). Добавляли РНК-полимеразу Т7 (собственного производства) и образцы инкубировали при 37 °С в течение не менее 4 часов. Реакцию останавливали добавлением ДНКазы I (ThermoFischer Scientific) до концентрации 1 ЕД/100 мкл и инкубацией при 37°С в течение 15 мин.Транскрибированную РНК очищали в 6% полиакриламидных гелях после смешивания 1:1 с денатурирующим загрузочным буфером (95% формамид, 18 мМ ЭДТА, 0,025% ДСН, бромфеноловый синий, ксиленцианол) и нагреванием до 95°С в течение 5 мин. Полосы геля визуализировали с помощью УФ-затенения, вырезали из геля и элюировали в течение ночи без нуклеазы H 2 O (Ambion). Кусочки геля отделяли от жидкости с помощью спин-колонок Freeze’n’Squeeze для выделения ДНК из геля ДНК (Bio-Rad), а затем РНК осаждали этанолом, ресуспендировали в не содержащей нуклеазы H 2 O и хранили при -20 °C. .

Тепловой отжиг структур РНК-оригами

Перед использованием транскрибированная РНК подвергалась тепловому отжигу для обеспечения правильной укладки структур РНК-оригами. Сначала РНК без нуклеазы H 2 O нагревали до 95°С в течение 5 мин, а затем быстро охлаждали до -20°С в течение 3 мин. Затем добавляли 5× сборочный буфер (5X TB, 625 мМ KCl, 5 мМ MgCl 2 ) до конечной концентрации 1×, и образцы оставляли при 37°C на 30 мин.

Измерения флуоресценции

Измерения флуоресценции проводились на FluoroMax 4 от Horiba, Jobin Yvon.Возбуждение DFHBI-1T и YO3-биотина проводили при 450 и 580 нм соответственно. Эмиссия DFHBI-1T и YO3-биотина регистрировалась при 503 нм и 620 нм соответственно. Щели монохроматора были установлены на 5 нм, а время интегрирования составляло 0,2 с. Измерения проводились на образцах объемом от 65 до 100 мкл, и использовались концентрации флуорофора 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина, если не указано иное. Относительные значения FRET рассчитывали по уравнению rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y}) + I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm D})}} \), где I DY DY ( EX D , EM Y ) — это выброс на длине волны YO3-биотина после возбуждения DFHBI-1T и I DY ( EX D , em D ) — излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина.

Анализы связывания и конкуренции флуорофора

Анализы активации и конкуренции флуорофора проводили на структурах РНК-оригами, содержащих только шпинат или только манго, или с пустой структурой 2H-AE (дополнительное примечание 1). Конструкции подвергали термическому отжигу перед измерениями в соответствии с приведенным выше протоколом. Концентрации как РНК, так и флуорофоров указаны на соответствующих рисунках. Измерения проводили в буфере сборки 1×.

Fluorophore EC

50 измерения

Измерялась аффинность связывания с различными флуорофорами аптамеров, интегрированных в структуры РНК-оригами. Конструкции подвергали тепловому отжигу перед использованием в соответствии с приведенным выше протоколом, а образцы готовили в буфере сборки 1×. Измерения проводились с использованием серийно разбавленных флуорофоров с концентрациями от 1 нМ до 2 мкМ. Все образцы готовили в трех повторностях как с 20 нМ РНК, так и без нее, и флуоресценцию измеряли на VarioSkan Flash Reader (Thermo Scientific) путем возбуждения образцов, содержащих DFHBI-1T или YO3-биотин, при 450 или 580 нм соответственно.Фоновая флуоресценция для каждой концентрации флуорофора в отсутствие РНК вычиталась из зарегистрированных интенсивностей перед вычислением ЕС 50 . EC 50 был рассчитан в GraphPad Prism 7.0b для Mac OS X с использованием нелинейного регрессионного анализа «логарифм (агонист) против ответа (три параметра)» кривой доза-реакция.

Измерения усиления флуоресценции

Усиление флуоресценции рассчитывали для флуорофоров в минимальной версии аптамеров и в аптамерах, интегрированных в структуры РНК-оригами.В целом, 1 мкМ РНК в 1× сборочном буфере инкубировали со 100 нМ соответствующего флуорофора. Усиление флуоресценции рассчитывали по уравнению \(F_{\rm {E}} = \frac{{I_{{\rm {F}} + {\rm {R}}}}}{{I _{\rm {F }}}}\), где I F+R — интенсивность флуоресценции флуорофора в присутствии РНК, а I F — интенсивность флуоресценции флуорофора отдельно (флуоресценция в выключенном состоянии).

Конформационные изменения в системе apta-FRET

Визуализация конформационных изменений в ответ на РНК-захватчик была выполнена с помощью измерений с временным разрешением системы apta-FRET, содержащей разветвленный KL.Флуоресценцию как DFHBI-1T, так и YO3-биотина регистрировали каждые 30 с, а между измерениями заслонки закрывали, чтобы избежать обесцвечивания. Обратимую инвазию получали, сначала добавляя РНК-захватчик с захватом до конечной концентрации 200 нМ к смеси 100 нМ структуры apta-FRET, 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина, а затем добавляя «анти-захватчик». ” до конечной концентрации 400 нМ. Выходы FRET были рассчитаны, как описано ранее.

Захватчик 1: UAGCUUAUCAGACUGAUGUUGAUAUAAAAG;

Анти-захватчик 1: КУУУУАУЦААККАУКАГУКУГАУААГКУА.

Захватчик 2: КУАГАКУГААГКУККУУГАГГГААГУУАГ;

Анти-захватчик 2: CUAACUUCCCUCAAGGAG CUUCAGUCUAG.

EC

50 измерения SAM в датчике apta-FRET SAM

Сродство связывания SAM в датчике S6-M19-SAM определяли путем инкубации с серийно разбавленным SAM в концентрациях от 1 мкМ до 2,5 мМ. Измерения проводились в трех повторностях с 50 нМ РНК в сборочном буфере, содержащем 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина. Измерения проводились в VarioSkan Flash Reader путем возбуждения образцов при 450 нм и записи спектров флуоресценции от 470 до 700 нм.Выходы FRET и EC 50 были рассчитаны, как описано ранее.

Процедура клонирования конструкций apta-FRET

Были выполнены стандартные этапы молекулярного клонирования. Во-первых, амплификацию и кодирование сайтов рестрикции ( Bgl II и Eco RI) на концах матриц ДНК проводили с помощью ПЦР-амплификации с использованием ДНК-полимеразы Phusion, как описано выше (последовательности праймеров см. в дополнительном примечании 2). После расщепления Bgl II и Eco RI (ThermoFischer Scientific — Fastdigest) в течение 30 мин при 37°C ДНК очищали с использованием набора для очистки GFX PCR (иллюстрация).pET28c-F30–2xdBroccoli был получен в подарок от Samie Jaffrey (плазмида Addgene # 66843). Плазмиду, приготовленную собственными силами на основе плазмиды pET28c, расщепляли с помощью Bgl II и EcoR I и очищали на 1% 0,5× TBE агарозном геле. Линеаризованную плазмиду pET28c экстрагировали из геля с помощью набора для извлечения из геля GFX (иллюстрация) и вставку лигировали в плазмиду в соотношении 1:3 путем инкубации с ДНК-лигазой Т4 при 16°С в течение ночи. Реакционную смесь лигирования использовали непосредственно для трансформации плазмиды в DH5-alfa E.coli (NEB) с использованием стандартной процедуры теплового шока. Трансформированные бактерии высевали на LB-агар с канамицином (Kan, 50 мкг/мл) и инкубировали в течение ночи при 37 °C. Отбирали отдельные колонии и инокулировали в LB-Kan (50 мкг/мл) в течение ночи при 37 °C при энергичном встряхивании. Плазмиды выделяли с использованием набора для минипрепарации плазмид GeneJET (ThermoFischer Scientific) перед проверкой секвенированием в GATC-Biotech. Положительные по последовательности плазмиды (~ 1 мкг) трансформировали в химически компетентный HT115 (DE3) E.coli собственного производства, а положительные трансформированные клоны отбирали с использованием чашек с LB-агаром с Kan (50 мкг/мл) и тетрациклином (Tet, 12,5 мкг/мл), как описано в Hull and Timmons 51 .

Процедура культивирования и установка

Ночную культуру (ON) получали путем инокуляции одиночных колоний HT115(DE3)-pET28c-FRET в 3 мл LB с помощью Kan (50 мкг/мл) и Tet (12,5 мкг/мл) и позволяли выращивать в аэробных условиях при 37 °C при энергичном встряхивании в течение ночи. Культуру разводили 1:100 в LB-Kan и инкубировали в тех же условиях до OD 600 ~0.25–35 (~ 3  ч). Затем к половине пробы добавляли IPTG (1 мМ) и культуры инкубировали в течение ~6–9 ч. Добавляли DFHBI-1T (50 мкМ) и YO3-биотин (85 мкМ) и инкубировали культуры в течение 30 мин. Различные культуры осаждали центрифугированием при 4000×g в течение 5 мин, затем повторно суспендировали в свежей соли 1× M9 (Sigma#M6030) и анализировали с помощью спектрофлуориметрии, проточной цитометрии или конфокальной микроскопии.

Спектрофлуориметрические измерения

Клетки, приготовленные, как описано выше, анализировали с помощью спектрофлуориметрических измерений в объеме 50 мкл. Были приготовлены образцы, содержащие как DFHBI-1T, так и YO3-биотин, а также контроли, содержащие только DFHBI-1T или YO3-биотин.Возбуждение DFHBI-1T и YO3-биотина проводили при 450 и 580 нм соответственно. Выходы FRET были рассчитаны путем первого расчета прямого возбуждения акцептора, которое, как было установлено, составляет 1,5% (см. Дополнительную таблицу 2) от общего выброса YO3-биотина с использованием уравнения: \(A _ {\ rm {dir}} = \ frac { {I _ {\ rm {Y}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} {{I _ {\ rm {Y}} (ex _ {\ rm {Y}}, em_{\rm {Y}})}}\), где \(I_Y(ex_D,em_Y)\) — эмиссия на длине волны биотина YO3 после возбуждения DFHBI-1T с присутствием только биотина YO3, а I Y ( ex Y , em Y ) представляет собой излучение на длине волны YO3-биотина после возбуждения YO3-биотина с присутствием только YO3-биотина.Далее определяли интенсивность излучения хвоста DFHBI-1T на длине волны YO3-биотин; было рассчитано, что оно составляет 7,4% (дополнительная таблица 2) от максимального выброса DFHBI-1T с использованием уравнения: \(D_{\rm {leak}} = \frac{{I_{\rm {D}}(ex_{\ rm {D}}, em _ {\ rm {D}})}} {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} \) , где I D ( ex D , em D ) – излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T при наличии только ( ex D , em Y ) представляет собой эмиссию на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только DFHBI-1T.\ ast I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) + I _ {\ rm {DY}} (ex _ {\ rm {D}}, em_ { \rm {D}})}}\), где \(I_{\rm {DY}}(ex_{\rm {D}},em_{\rm {Y}})\) — эмиссия на YO3- длина волны биотина после возбуждения DFHBI-1T, \(I_{\rm {DY}}(ex_{\rm {Y}},em_{\rm {Y}})\) — излучение на длине волны YO3-биотин после YO3- возбуждения биотина, а \(I_{\rm {DY}}(ex_{\rm {D}},em_{\rm {D}})\) — излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T, все три с присутствием как DFHBI-1T, так и YO3-биотина.

Проточная цитометрия

Те же образцы, которые использовались для спектрофлуориметрических измерений (~50 мкл), были разведены в 950 мкл соли 1× M9 перед измерением на проточном цитометре Beckmann Coulter Gallios с лазером 488 нм и FL1 (575/30) и детекторные фильтры FL3(620/30).Для обработки данных использовалось программное обеспечение Kaluza Analysis. Испускание флуоресценции измеряли на 50 000 незащищенных клеток, содержащих как DFHBI-1T и YO3-биотин, так и содержащих только DFHBI-1T или YO3-биотин. Среднее геометрическое интенсивности клеток 2H-AE с гейтом использовали в качестве фона и вычитали из средней геометрической интенсивности, измеренной на клетках с гейтом, содержащих структуры apta-FRET. Интенсивность, возникающая от DFHBI-1T в канале FL3, была найдена с помощью \(D_{{\rm {leak}}} = \frac{{FL3_{\rm {D}}}}{{FL1_{\rm {D} }}}\), где FL3 D и FL1 D — средние геометрические интенсивности в каналах FL3 и FL1 соответственно для клеток, содержащих только DFHBI-1T.\ast FL1_{{\rm {DY}}} + FL1_{{\rm {DY}}}}}\, где \(FL3_{{\rm {DY}}}\) — эмиссия на YO3-биотин длина волны после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина, \(FL3_{\rm {Y}}\) представляет собой излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, и \(FL1_{\rm {DY}}\) представляет собой излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина.

Флуоресцентная микроскопия

Изображения флуоресцентной микроскопии были получены с помощью Zeiss LSM 800 с масляным объективом 100X.Бактерии иммобилизовали на покрытых поли-L-лизином (PLL) 96-луночных планшетах (µ-Plate, без покрытия, там же). В лунки наносили 200 мкл PLL (10 мг/мл) на 30 мин при 37 °C, затем промывали безнуклеазным раствором H 2 O и сушили. В лунки добавляли 50 мкл культуры, приготовленной, как описано выше, в солях 1X M9, содержащих 100 мкМ DFHBI-1T и 17 мкМ YO3-биотина. DFHBI-1T возбуждали с помощью лазера 488 нм и регистрировали с помощью фильтра EGPF, а YO3-биотин возбуждали с помощью лазера с длиной волны 555 нм и регистрировали с помощью фильтра Texas Red.Сигнал FRET получали путем возбуждения с помощью лазера с длиной волны 488 нм и регистрации с использованием красного фильтра Texas. Записанные изображения были обработаны в MatLab (код доступен на нашей веб-странице www.andersen-lab.dk), где канал DFHBI-1T использовался для локализации отдельных клеток и определения их границ. Средняя интенсивность на пиксель в каждой ячейке рассчитывалась для всех трех каналов. Клетки отбирали с использованием непосредственно возбуждаемой флуоресценции YO3-биотина, а клетки с нижней 5%-ной интенсивностью, которая соответствует клеткам, не проявляющим флуоресценции YO3-биотина или проявляющим очень низкую флуоресценцию, отбрасывали.Значения каналов FRET и DFHBI-1T остальных ячеек использовались для расчета относительных выходов FRET с использованием уравнения \({\rm {FRET}} = \frac{{{I _{\mathrm{DY}}}( {ex_{\mathrm D}}, {em_{\mathrm Y}})}}{{{I _{\mathrm{DY}}}( {ex_{\mathrm D}}, {em_{\mathrm Y}} )} + {{I_{\mathrm{DY}}}( {ex_{\mathrm D}}, {em_{\mathrm D}})}}\), где \(I_{\mathrm{DY}} { ( {ex_{\mathrm D}}, {em_{\mathrm Y}})}\) — эмиссия на длине волны YO3-биотин (фильтр Texas Red) после возбуждения DFHBI-1T и \(I_{\mathrm{DY} } {( {ex_{\mathrm{D}}}, {em_{\mathrm D}}}}\) — излучение на длине волны DFHBI-1T (фильтр EGFP) после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина. Тепловая карта FRET была создана путем расчета относительного выхода FRET на пиксель в пределах границ выбранных ячеек с использованием того же уравнения.

Доступность данных

Авторы заявляют, что основные данные, подтверждающие результаты этого исследования, доступны в статье и файле с дополнительной информацией. Дополнительные данные можно получить у соответствующего автора по запросу.

Rivian теряет свой блеск, так как инвесторы беспокоятся о задержках производства

Компания также не сообщила инвесторам, что ее главный операционный директор Род Копс, ветеран Harley-Davidson, покинул компанию в прошлом году.Публичные компании и компании, находящиеся в процессе листинга своих акций, обычно раскрывают сведения об уходе топ-менеджеров. Новость была впервые опубликована The Wall Street Journal.

Критический год для электромобилей

Популярность автомобилей с батарейным питанием стремительно растет во всем мире, несмотря на стагнацию автомобильного рынка в целом.

Г-жа Маст сказала, что г-н Коупс «поэтапно перешел из Rivian осенью 2021 года, до IPO», и вышел на пенсию в декабре, после размещения.

г.55-летний Коупс сказал в интервью, что покинул Rivian не из-за беспокойства по поводу своей работы или из-за проблем с производством. Он сказал, что достиг ключевых целей и что структура для наращивания производства Rivian создана. «Это был плавный и плавный переход», — сказал г-н Коупс.

Но эксперты по корпоративному управлению считают, что Ривиан должен был сообщить инвесторам о своем предстоящем уходе во время IPO, учитывая его руководящую должность. «Если бы они знали, что он уходит, оптимальным раскрытием информации было бы опознание их С.О.О. но укажите, что он уезжает», — написал в электронном письме профессор Колумбийского юридического факультета Джон К. Коффи-младший.

По словам одного из бывших руководителей, в Rivian плохая культура управления.

Исполнительный директор Лаура Шваб сказала, что в прошлом году ее уволили с высокопоставленной должности в области продаж и маркетинга после того, как она выразила обеспокоенность по поводу того, что она назвала «культурой клубов для мальчиков» и «гендерной дискриминацией» в компании. Она подала иск в суд штата Калифорния, обвинив Rivian в нарушении закона штата, запрещающего дискриминацию при приеме на работу и месть.

Г-жа Шваб сказала, что она участвовала в 30 презентациях автомобилей на предыдущих должностях в автомобильной промышленности, в том числе в Aston Martin и Jaguar Land Rover. По ее словам, вскоре после прибытия в Rivian она почувствовала необходимость выразить обеспокоенность по поводу того, что компании угрожает невыполнение поставленных задач.

«Производственная линия не переходит с нуля на тысячи автомобилей за одну ночь; это просто так не работает», — сказала она.

Почему 10 лад? — Дискуссионные форумы


Обратите внимание, что это заархивированная тема , поэтому она заблокирована и на нее нельзя ответить.Однако вы можете создать новую тему и обратиться к ней по ссылке: http://www.banjohangout.org/archive/146860

.

Quickstep192 — Опубликовано — 01.05.2009: 07:43:57


Мне любопытно, почему у банджо есть маркер положения на 10-м ладу, когда у других инструментов, таких как гитары, есть маркер на 9-м ладу.

Майк Грегори — Опубликовано — 01.05.2009: 07:57:30


От кого:
ПОЛНАЯ ИСТОРИЯ БАНДЖО

Эта страница BLANK!!!!
Теперь я понятия не имею о !

— Шур Нафф Холмс, старый добрый детектив-

Билл Роджерс — Опубликовано — 01.05.2009: 07:58:31


У многих старых банджо он находится на 9-м.Я не знаю, понял ли кто-нибудь, почему это изменение или почему большинство банджо отмечены 10-м номером, и так было много лет.

Билл

johann — Опубликовано — 01.05.2009: 08:05:30


Было ли время, грубо говоря, когда это изменение произошло? Я тоже был озадачен этим, как Холмс!

1four5 — Опубликовано — 01.05.2009: 08:22:53


Почти 2 года пытался к этому привыкнуть. Но все равно запутался, переходя между банджо и гитарой.Так как я не использую маркеры грифа, но ДЕЙСТВИТЕЛЬНО использую маркеры боковых точек. Я поставил боковые точки на обоих своих банджо на 9-м, и с тех пор жизнь прекрасна.

Декан


Отредактировал — 1four5 01.05.2009 08:25:48

Ира Гитлин — Опубликовано — 01.05.2009:  08:54:24


Я думаю, что маркер 10-го лада был предназначен для того, чтобы помочь играющим на банджо найти ноту C на 1-й струне — очень важный обратите внимание на те дни, когда наиболее часто использовалась настройка C, а C была, пожалуй, самой распространенной тональностью для игроков на банджо.Есть некоторые гитары, в том числе многие старые, а также Selmers, любимые цыганскими джазменами, у которых есть маркер на ладу 10 вместо лада 9.

RenoStyles — Опубликовано — 01.05.2009: 11:09:34


Может быть, это просто ВЫГЛЯДИТ лучше на более длинном грифе банджо?

Мартин

trapdoor2 — Опубликовано — 01.05.2009:  12:22:13


Когда-то человек научился играть на банджо (формальное обучение музыке), читая ноты.В те дни учили наизусть; то есть вы запомнили настройку и ноты на каждой позиции лада. Это становится намного проще, если понять, что система повторяется после 12-го лада и что если выучить только «отмеченные» позиции ладов, остальные можно легко сделать вывод. Кроме того, если настроен gCGBD (который был прежним стандартом… с ~ 1880-х по ~ 1940-е), маркеры положения образуют основные аккорды, когда перечеркнуты три нижние струны (все 4, если басовая струна настроена до D). И, поскольку общий строй действительно был основан на Cmaj, позиции барре являются обычными мажорными аккордами, используемыми для Cmaj (и Fmaj, распространенной модуляции в музыке банджо того времени).

В системе обозначений (для банджо) того времени положение станка широко использовалось для обозначения аппликатуры. Обычно это число над нотоносцем и буквы «B» (пример: 5B) или «PB» (пример: 5PB). Это подскажет читателю, что либо рассматриваемые ноты можно найти с помощью такта на 5-м ладу (в случае 5B), либо что указательный палец будет барре на 5-м ладу, а другие пальцы возьмут ноты выше этого (5PB). . Кроме того, часто встречается буква «P» (например, 5P), указывающая, что самая низкая нота в аккорде находится на 5-й позиции (5-й лад).

Итак, точка в 10-м имеет смысл с этой точки зрения. Имея его на 9-м месте, инкрустация выглядит немного лучше (для меня).

===Марк

«Если бы банджо нуждались в тональных кольцах, С. С. Стюарт сделал бы их такими.»

bigfeller — Опубликовано — 01/05/2009:  13:23:39


После 15 лет игры на гитаре и игры на банджо пару лет назад эта штука с маркером ладов до сих пор время от времени доставляет мне неприятности, Я так привык к 9 ладу.Я, как и Дин, в основном просто использую боковые точки, поэтому мне, возможно, придется подумать о смене маркера боковой точки на 9-й на моем банджо. Я думаю, что с люком что-то не так, когда у меня 4-я струна настроена на C, маркер на 10-м ладу помогает мне. Поскольку раньше это был стандартный строй с 4-м, настроенным на C, для меня это имеет смысл. Хотя откуда мне знать, я всего лишь гитарист.

dpetrzelka — Опубликовано — 01.05.2009:  13:37:20


Есть ли современные производители банджо, которые сделали сознательный выбор, чтобы разместить маркер на 9-м ладу, так как C и 10-й больше не являются стандартом ?

hhunter44 — Опубликовано — 01.05.2009:  16:16:35


Я поставлю маркеры там, где захочет покупатель, но должен сказать, что меня никогда не просили поставить маркеры на девятом ладу .У некоторых вообще не будет маркеров, у некоторых они будут расположены с одной или другой стороны грифа и сделаны почти из любого материала.
Это банджо — насколько я понимаю, правил нет. Кроме того, это дает гитаристам еще одну вещь, на которую можно пожаловаться на банджо.

Cheers,

Хью Хантер
MidnightSpecial Instruments
www.midnightspecial.ca

Quickstep192 — Опубликовано — 01.05.2009: 20:24:57


Какую банку червей я открыл для себя.Я делаю свою собственную инкрустация и, конечно же, я могу разместить ее в любом месте, где захочу. Я также играю на гитаре, поэтому отметка 9-го лада вместо 10-го может помочь мне научиться играть на банджо. Тем не менее, я еще не видел банджо с маркером на 9-м ладу. Что делать, что делать? Мне нужно пройти несколько ладов, прежде чем я доберусь до 9-го (или 10-го), так что у меня есть время помучать его.

pete hobbie — Опубликовано — 01.05.2009:  20:37:37


Первое банджо, которое я сделал Я поставил маркер на девять (после 20 лет без гитары), я не знал ничего лучше, надеюсь, ты не будет думать обо мне меньше.
Пит

Сейчас все лучше, чем когда-либо.

Жизнь тяжелая штука, еще тяжелее, если ты глупый.
Джон Уэйн

farmer bob — Опубликовано — 02.05.2009: 06:58:39


Я играл на гитаре и банджо 40 лет, и до сих пор меня сбивают с толку маркеры позиций. Теперь, когда я делаю банджо и имею возможность ставить маркеры где угодно, я все еще ставлю маркер на десятый лад из страха, что меня поразит молния бога банджо, если я нарушу традицию… ФБ.

1four5 — Опубликовано — 02.05.2009:  07:18:55


Эй, Роберт, я сделал это… и молний пока нет! Боже, я думал, что 2 года было достаточно долго!!! Еще на своем Калико, когда заделывал дырки, оставленные предыдущим владельцем (от шубб каподастра) в креплении, я залил 10-й, и добавил маркер 9-го лада. Точно так же, как мой Goodtime выше, больше никаких ошибок мозга из-за местоположения маркера ни на моем банджо, ни на гитаре.

Декан

хлопья — Опубликовано — 02.05.2009:  12:16:38


Я никогда особо не задумывался об этом, пока вы, ребята, не начали поднимать эту тему.

Майк

Я тихий сосед с большой морозильной камерой.

rexhunt — Опубликовано — 02.05.2009: 16:34:02


Я тоже об этом не думал. Для меня банджо — достаточно необычный зверь, поэтому я никогда не думаю о нем как о гитаре. Точно так же, как мандолина, настроенная на 5-й тон, меня не слишком беспокоит, поскольку она сильно отличается от всего остального — за исключением того, что у нее есть маркер на 10-м — по крайней мере, на Loar F5.

Рекс

Кевин Б. — Опубликовано — 02.05.2009:  16:58:57


Где-то на BHO однажды я прочитал сообщение (от Биджи? Стангера или кого-то, кто это объяснил). Вы можете поискать в архивах. Мне нравится 10-й лад, помеченный для резервного копирования и т. д., для меня это имеет большой смысл.

Вот один старый пост http://www.banjohangout.org/forum/a…IC_ID=128408

Кевин ( )==»=~

»Опоссум, это что» с на ужин. . .»


Отредактировано — Kevin B 02.05.2009 17:07:16

goldtopia — Опубликовано — 03.05.2009: 02:50:18


Банджо со вставками по всей длине грифа на каждом ладу нельзя было полагаться на то, чтобы увидеть, где вы находитесь на грифе.Даже на обычном грифе, если мне нужно, я бы посмотрел на точки на краю грифа. Если вы делаете банджо для себя и предпочитаете точки в окантовке 9-го лада вместо 10-го, мастер может сделать это за вас, или вы можете заменить его. Впрочем, меня не волнует, 9-й это или 10-й, к этому привыкаешь.

Bill.O

www.bluegrassminstrels.co.uk

Билл Роджерс — Опубликовано — 03.05.2009: 11:52:13


Я задал этот вопрос Хэнку Шварцу, эксперту по ранним банджо Фэрбенкса и инструментам той переходной эпохи, когда маркеры перешли от 9 к 10 на банджо.Он не только сказал, что понятия не имеет, но и указал, где Фэрбенкс поставил маркеры на своих ранних банджо: 6, 8, 11, 13 (!!). Разве это не сведет тебя с ума?

Билл

Исследование, основанное на FRET, выявило сайт-специфическую регуляцию белков контрольных точек положения веретена в центросомах дрожжей

Обобщенные комментарии к обзору:

Это интересное и важное исследование, посвященное механизму SPOC (веретенообразующей контрольной точки), который обеспечивает правильную сегрегацию ядер перед выходом из митоза.SPOC представляет собой механизм критической контрольной точки, который регулирует митотический выход (т. е. выше сети митотического выхода, MEN) в зависимости от состояния позиционирования веретена внутри клетки, чтобы обеспечить правильное разделение двух ядер на две дочерние клетки. Элегантная серия экспериментов FRET используется для оценки ассоциации Bfa1 с компонентами SPB Nud1 и Spc72. Данные показывают, что Bfa1 одновременно ассоциирует с Spc72 и Nud1, но именно ассоциация с Spc72 изменяется в зависимости от SPOC.

Рецензенты согласились с тем, что это исследование обеспечивает значительный прогресс в понимании молекулярного механизма SPOC. Новая роль Spc72 в качестве каркаса для Cdc5 и Kin4 является ключевым моментом этого исследования.

В этом отношении основная проблема заключалась в том, что данные FRET по-прежнему являются корреляционными, поскольку функциональное значение взаимодействий Spc72 (измеренных с помощью FRET) с компонентами SPOC не определено. Таким образом, эта корреляционная природа должна быть упомянута в тексте.

Наиболее строгим образом можно 1) картировать домены взаимодействия Spc72, которые рекрутируют Cdc5 и Kin4, затем 2) создать разделение функциональных аллелей для определения фенотипического результата, что обеспечит точную модель того, как Spc72 действует в SPOC сигнализация и 3) использовать систему FKBP-FRB для тестирования модели, манипулируя взаимодействием Spc72 с компонентами SPOC.

Однако рецензенты также согласились с тем, что вышеуказанные пункты 1 и 2 могут выходить за рамки текущей работы и что существующих данных, представленных в этой рукописи, достаточно для разработки рабочей модели (как показано на рисунке 6).Таким образом, рецензенты согласились с тем, что авторы должны описать свою модель того, как дифференциальное изменение в FRET Bfa1-Spc72 и Bfa1-Nud1 связано со способностью Cdc5 и Kin4 фосфорилировать Bfa1, и проверить модель с помощью дополнительных, относительно простых экспериментов. ) по линии вышеуказанной точки 3).

Благодарим рецензентов за предложение. Корреляционный характер данных FRET теперь упоминается в тексте (подраздел «Активация SPOC нарушает взаимодействие Bfa1-Spc72 через ветвь Kin4/Bmh2 SPOC», последний абзац).Теперь мы провели дополнительные эксперименты для проверки функциональной значимости изменения в FRET Bfa1-Spc72, а также для проверки модели, согласно которой диссоциация Bfa1 от Spc72 предотвращает ингибирующее фосфорилирование Bfa1 с помощью Cdc5. Как предложили обозреватели, мы манипулировали взаимодействием Spc72-Bfa1 так, чтобы Bfa1 оставался конститутивно связанным с Spc72. Для этого мы экспрессировали BFA1-GFP в клетках, несущих Spc72, слитый с GFP-связывающим белком (GBP). В присутствии Spc72-GBP Bfa1-GFP локализовался в обоих SPB независимо от положения веретена.Мы показываем, что клеток BFA1-GFP SPC72-GBP были дефицитны по SPOC, что указывает на функциональную значимость ремоделирования взаимодействия Bfa1-Spc72 при смещении веретена. Мы также показываем, что Bfa1-GFP становится гиперфосфорилированным в обработанных нокодазолом клетках SPC72-GBP , но не в клетках SPC72 . Истощение CDC5 значительно уменьшило гиперфосфорилирование Bfa1-GFP в клетках SPC72-GBP , установив вклад взаимодействия Bfa1-Spc72 в фосфорилирование Cdc5 Bfa1. KIN4 также фосфорилировал Bfa1-GFP в клетках SPC72-GBP . Эти данные показывают, что Kin4 и Cdc5 фосфорилируют Bfa1 при активации SPOC, если Bfa1 остается конститутивно связанным с Spc72. Эти новые данные подтверждают нашу модель и теперь показаны на рисунке 7, объясняются в подразделе «Взаимодействие Bfa1-Spc72 усиливает фосфорилирование Bfa1 с помощью Cdc5 и Kin4» и обсуждаются в подразделе «Рецептор Spc72 комплекса γ-тубулина координирует активацию и ингибирование Bfa1». — Буб2». Мы также описали модель в легенде к рисунку 7.

[Примечание редактора: перед принятием были запрошены дополнительные изменения, как описано ниже.]

Рецензент №3:

Мое главное предложение авторам состоит в том, чтобы они уточнили все следствия своих экспериментальных результатов и четко обсудили альтернативные модели, которые также согласуются с данными.

1) Устранить несоответствие в отношении предложенной модели одновременного взаимодействия одного Bfa1 с Nud1 и Spc72.

Авторы использовали FRET между С-концом Spc72 и С-концом Bfa1 и анализ in vitro, чтобы сделать вывод о том, что они взаимодействуют (рис. 1В). Однако авторы также обнаружили, что делеция Spc72 не оказывает какого-либо заметного влияния на стационарное рекрутирование Bfa1 или скорость его оборота в SPB (рис. 4D-F). Авторы примиряют эти находки, утверждая, что одна и та же молекула Bfa1 одновременно взаимодействует как с Spc72, так и с Nud1.

Если два сайта связывания находятся в непосредственной физической близости, то можно ожидать, что их совокупная аффинность будет больше, чем сумма индивидуальных аффинностей.Даже если это ожидание каким-то образом не актуально в данном случае, делеция одного из двух сайтов связывания (Spc72) должна иметь измеримый эффект либо на рекрутирование, либо на оборот Bfa1. Данные in vivo этого не подтверждают.

Я могу назвать четыре возможные причины этих противоречивых данных: (1) мутация/супрессор противодействует эффекту делеции Spc72 на рекрутирование Bfa1, (2) повышенная стехиометрия Bfa1:Nud1 в штамме spc72Δ точно компенсирует потерю одного сайта связывания, (3) аффинность сайта связывания Bfa1 в Spc72 очень низкая, и Nud1 в основном отвечает за рекрутирование Bfa1, и (4) результат in vitro является артефактом; Spc72 не взаимодействует с Bfa1 in vivo.Следует отметить, что FRET Spc72-Bfa1 является коррелятивным. Изменения в этом FRET могут просто отражать увеличение разделения между флуорофорами из-за связывания Bmh2 с Bfa1.

Авторы должны четко обсудить несоответствие результатов in vivo и in vitro и другие возможные интерпретации данных.

Теперь мы добавили новый раздел в обсуждение («Вклад Nud1 и Spc72 в поведение привязки Bfa1 SPB»). В этом разделе мы обсудим, связывается ли Bfa1 с Nud1 и Spc72 по отдельности или одновременно.Мы обсуждаем наши данные in vitro и FRET, а также данные, полученные в результате анализа поведения связывания Bfa1 SPB в клетках spc72∆ . Мы также обсуждаем несоответствия данных in vitro и in vivo (в отношении вклада Spc72 в поведение связывания Bfa1 SPB):

«Вклад Nud1 и Spc72 в поведение привязки Bfa1 SPB:

Биохимические данные и данные FRET согласуются со связыванием Bfa1 с Nud1 и Spc72. Это поднимает вопрос о том, как Bfa1 связывается с этими белками в SPB.Bfa1 может связываться отдельно или одновременно с Nud1 и Spc72. […] В любом случае потребуются дальнейшие биохимические и биофизические исследования, чтобы оценить сродство Bfa1 к Nud1 и Spc72 и установить, может ли одна и та же молекула Bfa1 одновременно связываться с Nud1 и Spc72».

Теперь мы обсудим, что потеря FRET также может указывать на разделение только флуорофоров:

«Мы наблюдали потерю Bfa1-Spc72 (но не Bfa1-Nud1) FRET при активации SPOC. Потеря сигнала FRET между Bfa1 и Spc72 может указывать на физическое разделение двух белков или только на разделение флуорофоров, связанных с C-концами Bfa1 и Spc72.[…] Такая регуляция может напоминать конформационные изменения, которые претерпевает Mad2 при активации контрольной точки сборки веретена (SAC) (Luo et al., 2002; Luo et al., 2004; Mapelli et al., 2007; Mapelli and Musacchio, 2007). ; Sironi et al., 2002; Yang et al., 2007)».

2) Обсудите все возможные причины возникновения асимметричного набора Bfa1 у матери и дочери SPB.

Обсуждаемый выше момент также влияет на объяснение авторов того, почему дочерний SPB рекрутирует более высокие количества Bfa1.Авторы отмечают, что «ранее корреляционные эксперименты исключали возможность того, что возрастная разница двух SPB может объяснить предпочтительное связывание комплексов Bfa1-Bub2 с dSPB (Juanes et al., 2013; Pereira et al., 2001). Однако эти исследования не исключали возможности того, что асимметрия возникла из-за ассоциации комплексов Bfa1-Bub2 с разными молекулами в материнской и дочерней SPB».

Если модель авторов о том, что Spc72 является Nud1-независимым рецептором Bfa1, верна, то им следует уточнить, что сам Spc72 асимметрично распределен в SPB матери и дочери.Фактически, Хуанес и др. исследование показывает, что эта асимметрия уровней Spc72 отвечает за ориентацию дочерних SPB.

С другой стороны, если Spc72 не обеспечивает значительного интерфейса связывания для Bfa1, как обсуждалось в пункте #1, тогда асимметрия может возникнуть из-за дифференциальной фосфорорегуляции Bfa1 в материнских и дочерних SPB.

Мы расширяем раздел об асимметричном связывании Bfa1 SPB, чтобы обсудить роль посттрансляционных модификаций и возраст SPB (включая асимметрию Spc72):

«Асимметричная ассоциация Bfa1 с SPB в клетках с правильно выровненными веретенами:

Комплекс Bfa1-Bub2 рекрутируется преимущественно на dSPB (асимметричное связывание) в клетках, нормально проходящих клеточный цикл.[…] Как детерминанты клеточной полярности контролируют асимметрию Bfa1, неясно. Факторы, связанные с дочерними клетками, могут стабилизировать взаимодействие Bfa1-Nud1 в dSPB, например, влияя на посттрансляционную регуляцию Bfa1-Bub2 или Nud1».

3) Процитируйте предшествующие исследования, которые демонстрируют, что удовлетворение митотической контрольной точки локально создает доминирующий сигнал, который глобально подавляет контрольную точку.

По крайней мере, два предшествующих исследования демонстрируют, что требуется очень мало, чтобы изменить баланс биохимии клеточного цикла: (a) «Синхронное разрушение ядерной оболочки и начало анафазы в многоядерных клетках растений» Protoplasma (2001) 218:192-202, и (b) «Митоз в соматических клетках позвоночных с двумя веретенами: значение для контрольной точки перехода метафазы/анафазы и расщепления» PNAS 94, стр.5107-5112. MEN дрожжей, по-видимому, является последним примером этого интригующего аспекта клеточного цикла.

Мы благодарим рецензента за это предложение. Теперь мы обсудим предыдущую работу, показывающую поведение контрольных точек в двуядерных клетках:

.

«Важно, что наши данные показывают, что стоп-сигнал выхода из митоза, генерируемый SPOC в смещенном веретене, не может поддерживать остановку митоза, если контрольная точка удовлетворяется в соседнем веретене. […] Мы постулируем, что несбалансированная целостность контрольных точек в двуядерных клетках может быть движущей силой нестабильности генома и развития рака.

https://doi.org/10.7554/eLife.14029.042 .

Добавить комментарий

Ваш адрес email не будет опубликован.