Газ 69 характеристика: ГАЗ-69 технические характеристики автомобиля в таблице

Содержание

Автомобиль ГАЗ-69А технические характеристики фотографии.

Характеристики фотографии

ГАЗ-69А
1952-1972 гг.

Фотография ГАЗ-69


ГАЗ 69 восмиместный, с двумя дверями и откидным бортом
ГАЗ-69А пятиместный, с четырьмя дверями и багажником
ГАЗ-69Э с экранированным электрооборудованием
ГАЗ-69М восмиместный, с двумя дверями и откидным бортом. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин.
ГАЗ-69МЭ восмиместный, с двумя дверями и откидным бортом. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин. С экранированным электрооборудованием
ГАЗ-69АМ пятиместный, с четырьмя дверями и багажником. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин.
ГАЗ-69АМЭ восмиместный, с двумя дверями и откидным бортом.
Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин. С экранированным электрооборудованием
ГАЗ-69-68 восмиместный, с двумя дверями и откидным бортом.
ГАЗ-69А-68 пятиместный, с четырьмя дверями и багажником.
ГАЗ-69П Милиция
ГАЗ-69 Т3-П тротуароуборочная машина
ГАЗ-69 Т5 подметально-уборочная машина
ЛФМ-ГПИ-29 (ЛФМ-1) ледово-фрезерная машина для подготовки взлётно-посадочных полос на ледовых аэродромах
ГАЗ-69Б
почтовый сельский
АПА-12 аэродромный пусковой агрегат (для электростартерного запуска ТРД)
АПА-12Б модификация АПА-12 с дополнительно установленной гидравлической системой
АТ-3 , АТ-4М аэродромный транспортер, для механизированной загрузки грузов, почты и багажа в транспортные отсеки воздушных судов.
ГАЗ-69А АШП-4 Штабная пожарная машина
ГАЗ 69 — ПМГ-20 (АНП-20) автонасос пожарный
ПМГ-29 (АЦПТ-20) пожарный автомобиль
ГАЗ-69 ЛСД санитарный фургон
СВП-69М автомобиль скорой ветеринарной помощи
ГАЗ-69А АШ-4 штабной автомобиль
ГАЗ-69 ДИМ дорожный индукционный миноискатель
ГАЗ-69ТМ (ТМГ) топопривязчик армейский, с навигационной аппаратурой

В 1946 году Горьковским автозаводом было получено официальное техническое задание на проектирование полноприводного легкового автомобиля высокой проходимости под индексом ГАЗ-69. В соответствии с постановлением СМ СССР от 21.04.1947 года и тактико-техническими требованиями Главного артиллерийского управления ГАЗ должен был разработать проект легкого армейского автомобиля-тягача для буксировки прицепов (батальонных артсистем) весом до 800 кг, а так же перевозки боеприпасов, крупнокалиберных пулеметов, 82-мм минометов и их боевых расчетов. Без прицепа планировались машина связи, разведки, командирская, тягач легких противотанковых пушек. ГАЗ-69 проектировался заново, c «нуля», однако в работе над машиной использовался богатый опыт, накопленный заводом в годы Великой Отечественной войны, а также опыт эксплуатации в войсках американских Виллисов и «Бантамов». По сравнению с ними вместимость и грузоподъемность были увеличены до 8 человек со снаряжением или 0,65 т, что соответствовало ожидаемым условиям эксплуатации и заметно расширяло сферу применения этого автомобиля, становившегося уже универсальным — грузопассажирским: задний отсек кузова имел два продольных сиденья на 6 человек, поднимая которые можно было освободить платформу для груза до 500 кг.

Фотография ГАЗ-69А

Ведущим конструктором ГАЗ-69 был Григорий Моисеевич Вассерман. Несмотря на то, что и до, и после этого он создал немало удачных легковых вездеходов, ГАЗ-69А, безусловно, стал лучшим из них. Общую компоновку, как и предыдущих легковых машин ГАЗ, с большим искусством сделал Ф.А.Лепендин. Немалый вклад в создание ГАЗ-69 внесли «трансмиссионщики» В.С.Соловьев, Б.А.Дехтяр, С.Г.Зислин. Исключительно гармоничный и даже элегантный, закрытый (с брезентовым верхом и съемными боковинами дверей), с невиданным ранее комфортом (отоплением, вентиляцией и обдувом ветрового стекла) кузов модели «76» производит и сейчас хорошее впечатление. Он был спроектирован под руководством ведущего «кузовщика» Б.Н.Панкратова при активном участии Ю.А.Фокина.

Двигатель мощностью 50 л.с., сцепление и коробка передач с измененными передаточными числами, использовался от только что освоенной «Победы». Прежнему ГАЗ-67Б такой мощности (50…54 л.с.) вполне хватало, однако новый двигатель, будучи более современным, долговечным и экономичным, имел значительно меньший аксимальный крутящий момент (12,5 кгм против 17…18 кгм у старого). Ограниченные энергетические показатели двигателя М-20 (другим создатели не располагали) и соответственно меньшая по сравнению с ГАЗ-67Б и, особенно, Виллисом удельная
мощность
(собственная масса ГАЗ-69А неизбежно возрос из-за более емкого кузова и усиления конструкции) потребовали улучшить его моментную характеристику, особенно в области низких оборотов. Для достижения этого необходимо было снизить потери мощности и увеличить передаточные числа в трансмиссии. С этой целью, в соответствии с прежними разработками, в раздаточную коробку, расположенную на этот раз отдельно от силового агрегата, ввели двухступенчатый демультипликатор с необычно высоким силовым диапазоном — 2,6 и предусмотрели возможность отбора мощности от нее для привода вспомогательных агрегатов. Трехвальная схема РК (без прямой передачи) позволяла широко менять передаточные числа и облегчала их точный подбор.

Фотография ГАЗ 69 Снегоболотоход

Карданные шарниры, колесные тормоза с гидроприводом, рулевой механизм и задние амортизаторы использовались от Победы, а ведущие мосты — от ГАЗ-67Б (со ступицами колес на конических роликоподшипниках и разгруженными полуосями). Ручной тормоз — центральный, дисковый, как на ГАЗ-51 . У него же позаимствовали и контрольные приборы, осветительную арматуру, пусковой подогреватель. Явно малые шины размером 6,5-16» с рисунком «расчлененная елка» — от ГАЗ-67Б. Классическая подвеска — на четырех удлиненных полуэллиптических излишне жестких рессорах с параболическим профилем листов и резиновыми втулками — по типу задних ГАЗ М-20 «Победа». Рама с закрытыми лонжеронами, легкая и прочная, в дальнейшем не потребовала серьезных изменений. Кузов при увеличении длины всего на 0,5 м имел в два раза большую емкость. К октябрю 1947 года первый образец (Э-I) опытной серии ГАЗ-69-76 уже был построен, к февралю 1948 года выпустили еще два, а к концу года — четвертый (Э-IV). Все они снабжались специальными одноосными прицепами ГАЗ-704 для груза массой до 0,5 т. Эти машины отличались в основном передаточными отношениями главных передач (6,17 и 5,43) и элементами рамы.

УАЗ-456 полуприцеп

Фотография УАЗ-456 полуприцеп

Опытный седельный тягач УАЗ-456 с двухосным полуприцепом УАЗ-749. Отличается от ГАЗ-69 установкой седельно-сцепного устройства вместо задней части кузова, и наличием полуприцепа УАЗ-749 грузоподъемностью 2 тонны.

Заводские испытания в жестких условиях с пробегом 12 500 км, проведённые в мае 1948 года под руководством бессменного ведущего испытателя ГАЗ-69 инженера А. Ф. Ромачева, показали, что новый автомобиль в целом удовлетворяет предъявленным к нему требованиям. Он имел сухую массу 1363 кг, снаряженную — 1470 кг, с полной нагрузкой — 2110 кг. Тяговые свойства машины были очень высокими: 69.9% от полного веса без прицепа и 50,7% с прицепом, в ущерб максимальной скорости — всего 75 км/ч (сказывалась невысокая удельная мощность). Позже тяговые усилия снизили до приемлемых значений (1350 кгс по грунту), а скорость увеличили. Угол подъема по сухому дерну достигал 34° (с прицепом — 23°), спуск без «юза» — 30°. Уверенно преодолевалось тяжелое бездорожье со слоем грязи до 0,25 м (с цепями — 0.3 м) и броды глубиной до 0,7 м. Как только ГАЗ-69 появился на свет, его стали активно испытывать в экстремальных условиях. Так, весной 1949 года в качестве командорской машины он принял участие в знаменитом пробеге ГАЗ-63А и ЗИС-151 по абсолютному бездорожью. Будучи автомобилем более легкой категории, он эти испытания, где трехосные «утюги» ЗИС-151 застревали намертво, выдержал достойно, как и ветеран ГАЗ-67Б, не говоря уже о зачетных ГАЗ-53. Это было торжество «газовской» школы конструкторов вездеходов, сложившейся к концу войны. ГАЗ-69 преодолевал свежий снег глубиной до 0,4 м, уплотненный весенний — до 0,3 м, рвы — до 0,55 м и шириной 0.4 м. Сравнительные испытания его вместе с ГАЗ-67Б проведенные весной 1950 года, показали, что минимальный расход топлива на шоссе снизился с 13,9 до 10,9 л (с прицепом — 12,1 л) — следствие более экономичного двигателя, несмотря на возросшую полную массу машины.

Фотография модификация ГАЗ-69 АПА-12

В процессе доводки мощность двигателя возросла до гарантированных 55 л.с. (на стендах — 58,5 л.с.). Это, в свою очередь, увеличило, хотя и меньше, чем требовалось, крутящий момент — до 12 7 кгм (на стендах — до 13,6 кгм). Были установлены маслорадиатор и шестилопастный вентилятор, что полностью устраняло перегревы в сложных дорожных условиях; откорректированы передаточные числа в трансмиссии; применена синхронизированная коробка передач от ГАЗ-12 «ЗИМ». Устаревшие и недостаточно надежные мосты, доставшиеся в основном от ГАЗ-11 и ГАЗ-61, заменили на ставшие общепризнанными конструкции с фланцевыми, полностью разгруженными полуосями по типу ГАЗ-63. Использована геометрия отработанной конической пары главной передачи от Победы (5,125). Применены более жесткие картеры главных передач типа «Сплит», разработанные В.С.Соловьевым (будущим главным конструктором ВАЗ) для модернизированной «Победы», но так на ней и не внедренные. Кроме того, была использована двухсателлитная неразъемная коробка дифференциала от ГАЗ-12 «ЗИМ». От него же — более совершенный рулевой механизм, облегчающий управление. Дисковый ручной тормоз заменили на барабанный. Усилили раму, особенно в районе 1-й поперечины. Установили стандартные для армейской техники круглые контрольные приборы.

Фотография ГАЗ-69 без тента

В мае 1951 года появился новый вариант — ГАЗ-69А с 5-местным пассажирским 4-дверным кузовом модели «77». Масса машины, естественно, повысилась в среднем на 60 кг, длина увеличилась на 30 мм, ширина — на 35 мм. высота — на 60 мм. Максимальная скорость возросла до 90 км/ч, минимальная же составляла всего 3,6 км/ч (с прицепом — 3 км/ч), а средняя скорость движения по грязному проселку — 20…25 км/ч (с прицепом — 15…20 км/ч). Контрольный расход топлива на шоссе снизился до рекордного для легковых вездеходов значения — 10,4 л (с прицепом — 11,9 л).     По решению правительства с конца 1954 года производство ГАЗ-69 стало переводиться на значительно расширенный и переоборудованный Ульяновский автозавод (УАЗ), возвращенный из системы радиопрома и с тех пор специализирующийся в проектировании и выпуске малотоннажных автомобилей повышенной проходимости. В декабре там уже собрали первые шесть ГАЗ69. Всего же с 1953 по 1956 год горьковчане выпустили 16 382 ГАЗ-69 и 20 543 ГАЗ-69А. С 1955 года они в возрастающем количестве поставляли по кооперации на УАЗ комплекты для сборки машин.

ГАЗ-69 компоновка в разрезе

Полностью выпуск ГАЗ-69 ульяновцы освоили в 1956 году. Для развития этого направления на завод была направлена группа высококвалифицированных инженерно-технических работников во главе с главным конструктором П. И. Музюкиным — активным разработчиком многих вездеходов ГАЗ. Результаты не замедлили сказаться — в рекордно короткие сроки на УАЗе спроектировали и в 1957 году построили на базе ГАЗ-69 первую самостоятельную и достаточно удачную машину, не имевшую аналогов в мире, — фургон «4х4» вагонной компоновки малой грузоподъемности (0,75 т) УАЗ-450 с разными вариантами кузовов, запущенную в производство в феврале 1958 года. С 1956 года ГАЗ-69 стал успешно экспортироваться за границу (56 стран) в том числе в тропическом исполнении, где также быстро приобрел большую популярность, особенно в странах Азии, Африки и Латинской Америки. В Румынии и Китае ГАЗ-69 производились без лицензии, в Румынии под своим обозначением АРО-461. Правда, по качеству они заметно уступали советским ГАЗ-69 и конкуренцию составить не могли.     В процессе производства машина непрерывно совершенствовалась Так, в 60-е годы внедрили передний мост с отключением ступиц колес и усиленными подшипниками, более надежный дифференциал с четырьмя сателлитами, установили развитые шкворневые узлы, улучшили уплотнения карданов, доработали тормоза. Велись работы по повышению долговечности синхронных шарниров привода передних колес, в частности путем установки надежных дисковых типа «Тракта-ЯАЗ». Военный ГАЗ-69 производился вплоть до 1973 года, когда были выпущены последние 275 машин. В целом удачная и добротная конструкция «газика» — полностью себя оправдала, что позволило этому автомобилю проникнуть во все уголки нашей страны, завоевать уважение водителей, честно послужить в армии и уверенно эксплуатироваться до сих пор. Всего УАЗ выпустил машин: УАЗ-69 — 356 624, УАЗ-69А-230 185, УАЗ-69АМ и УАЗ-69М — 10 551. Итого по двум заводам — 634 285 ГАЗ-69 всех модификаций.

ГАЗ-69 фотографии

Фотография ГАЗ-69 АПА-12


Фотография ГАЗ-69 Т3


Фотография ГАЗ-69 в пустыне Египта


ГАЗ-19 короткая история

Фотография ГАЗ-19 Связь

Освоив в 1953–54 годах выпуск автомобилей семейства ГАЗ-69 с колесной формулой 4х4, Горьковский автозавод выполнил разработку оригинальной заднеприводной версии вездехода, получившей условный индекс ГАЗ-19. Помимо того что производственная программа ГАЗа расширилась бы за счет перспективного “паркетника”, этот автомобиль, оснащенный не тентованным, а закрытым цельнометаллическим кузовом-фургоном, мог бы использоваться для перевозки почты и других универсальных грузов массой до 600 кг, а также в аварийных службах и органах МВД.
    Конструкция автомобиля, полностью унифицированная с другими машинами ГАЗ, обеспечивала легкость обслуживания и надежность работы в любых дорожных условиях. Кузов машины имел две боковые двери и одну двустворчатую, расположенную в задней стенке. Он существовал в двух вариантах — с глухими и застекленными (модификация ГАЗ-19А) боковыми бортами. Грузовое помещение было отделено перегородкой от передних сидений, предназначавшихся для водителя и пассажира.
    Маневренность ГАЗ-19 обеспечивалась его короткой (2300 мм) базой и небольшими габаритами: длина — 3850 мм, ширина — 1750 мм, высота без нагрузки — 1950 мм, колея — 1440 мм. Дорожный просвет у ГАЗ-19 составлялл 210 мм, наибольшая скорость с полной нагрузкой — 90 км/ч. Двигатель, как и у вездехода ГАЗ-69, был бензиновый, карбюраторный, 4-цилиндровый, с рабочим объемом 2,12 л, степенью сжатия 6,5 и мощностью 55 л. с. при 3600 об/мин.

В 1956 году ГАЗ-19 демонстрировался на выставке продукции отечественного автопрома в Москве, но в серию так и не пошел. В качестве причины, не позволившей освоить его производство, называлось отсутствие готовой кованой балки переднего моста, изготовление которой якобы оказалось бы экономически невыгодным ввиду относительно небольшой — в сравнении с армией и сельским хозяйством — потребности в подобных автомобилях. Тем не менее впоследствии, с передачей производства автомобилей ГАЗ-69 и ГАЗ-69А на Ульяновский автозавод, ковка подобной балки все же была налажена для выпуска неполноприводных УАЗ-451.

ГАЗ-69 технические характеристики

Технические характеристики ГАЗ-69
Годы выпуска 1952-1972 гг.
Тип автомобиля автомобиль повышенной проходимости
Колёсная формула 4 х 4
Число мест 5 и 50 кг. в багажнике
Габариты
Длина/Ширина/Высота 3850/1750/2030 мм.
Колесная база 2300 мм.
Колея передняя/задняя 1440/1440 мм.
Масса 1525 кг.
Дорожный просвет (клиренс) 210 мм.
Наименьший радиус поворота наружный-6м. внешний-6,5м.
Двигатель
Двигатель ГАЗ-69
Материал Алюминий
Компоновка двигателя Передняя
Двигатель/система питания Бензиновый / Карбюраторная
Число цилиндров 4
Клапанов 8
Клапанный механизм нижний
Материал блока цилиндров серый чугун
Охлаждение Жидкостное
Диаметр цилиндров 82 мм.
Порядок работы цилиндров 1-2-4-3
Ход поршня 100 мм.
Степень сжатия 6,2-6,5
Число клапанов/расположение 8 / верхнее
Рабочий объём 2120 см3
Мощность 55 л.с. при 3600 об/мин.
Максимальный крутящий момент 127 Н·м при 2000-2200 об/мин.
Коробка передач трехступенчатая, двухходовая
Раздаточная коробка двухступенчатая
Динамика
Электрооборудование 12 V
Максимальная скорость 90 км/ч.
Норма расхода топлива 17,5 л. на 100 км.
Грузоподъёмность 2 чел.+500 кг.
Вес буксируемого прицепа 800 кг. (вес прицепа 300 кг.)
Размер шин 6,50-16″
Тормоз ножной колодочный, на все колёса
Тормоз ручной колодочный, на трансмиссию
Рулевой механизм глобоидальный червяк и двухгребневый ролик
Данные «Краткий автомобильный справочник» НИИАТ Автотрансиздат Москва 1958 год
ГАЗ 69 восмиместный, с двумя дверями и откидным бортом
ГАЗ-69А пятиместный, с четырьмя дверями и багажником
ГАЗ-69Э с экранированным электрооборудованием
ГАЗ-69М восмиместный, с двумя дверями и откидным бортом. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин.
ГАЗ-69МЭ восмиместный, с двумя дверями и откидным бортом. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин. С экранированным электрооборудованием
ГАЗ-69АМ пятиместный, с четырьмя дверями и багажником. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин.
ГАЗ-69АМЭ восмиместный, с двумя дверями и откидным бортом. Экспортный вариант с объемом двигателя 2.432 см, диаметр цилиндра 88 мм, 72 бензин. С экранированным электрооборудованием
ГАЗ-69-68 восмиместный, с двумя дверями и откидным бортом.
ГАЗ-69А-68 пятиместный, с четырьмя дверями и багажником.
ГАЗ-69П Милиция
ГАЗ-69 Т3-П тротуароуборочная машина
ГАЗ-69 Т5 подметально-уборочная машина
ЛФМ-ГПИ-29 (ЛФМ-1) ледово-фрезерная машина для подготовки взлётно-посадочных полос на ледовых аэродромах
ГАЗ-69Б почтовый сельский
АПА-12 аэродромный пусковой агрегат (для электростартерного запуска ТРД)
АПА-12Б модификация АПА-12 с дополнительно установленной гидравлической системой
АТ-3 , АТ-4М аэродромный транспортер, для механизированной загрузки грузов, почты и багажа в транспортные отсеки воздушных судов.
ГАЗ-69А АШП-4 Штабная пожарная машина
ГАЗ 69 — ПМГ-20 (АНП-20) автонасос пожарный
ПМГ-29 (АЦПТ-20) пожарный автомобиль
ГАЗ-69 ЛСД санитарный фургон
СВП-69М автомобиль скорой ветеринарной помощи
ГАЗ-69А АШ-4 штабной автомобиль
ГАЗ-69 ДИМ дорожный индукционный миноискатель
ГАЗ-69ТМ (ТМГ) топопривязчик армейский, с навигационной аппаратурой

ГАЗ-69 — ГАЗ-69А (4X4)

Технические характеристики автомобиля ГАЗ-69 — ГАЗ-69А

производство ГАЗ-69 Горьковский завод начал в 1953 году, причем параллельно (с декабря 1954 года) эти вездеходы собирал и Ульяновский автозавод. Полностью на выпуск ГАЗ-69 и его модификации ГАЗ-69А из узлов собственного производства УАЗ перешел после 1956 года. Со временем производство «шестьдесят девятых» было полностью передано на завод в Ульяновск. Производство ГАЗ-69 было прекращено в 1971 году. Автомобиль ГАЗ-69 завод выпускает двух моделей: восьмиместный — модель ГАЗ-69 и пятиместный — модель ГАЗ-69А. Конструкции обеих моделей одинаковы, за исключением кузова и бензиновых баков. Модификации автомобиля ГАЗ-69:

#i Автомобиль М-72 выпускался Горьковским заводом с середины 1955 года на шасси ГАЗ-69 с кузовом «Победы». Эта машина сходила с конвейера до 1958 года. #i Автомобиль амфибия ГАЗ-46.

Кузов ГАЗ-69 — цельнометаллический, открытый, восьмиместный, двухдверный, с задним откидным бортом и съемным тканевым тентом. Кузов ГАЗ-69А — цельнометаллический, открытый, пятиместный, четырехдверный, с багажником в задней части и опускающимся тканевым тентом. Грузоподъемность ГАЗ-69 — 8 чел. или 2 чел. на передних сидениях и 500 кг груза Грузоподъемность ГАЗ-69А — 5 чел. и 50 кг груза в багажнике Допустимая масса прицепа, кг — 850 Собственная масса ГАЗ-69, кг — 1525

#i В том числе на переднюю ось — 860 #i В том числе на заднюю ось — 665

Собственная масса ГАЗ-69А, кг — 1535

#i В том числе на переднюю ось — 820 #i В том числе на заднюю ось — 715

Полная масса ГАЗ-69, кг — 2175

#i В том числе на переднюю ось — 940 #i В том числе на заднюю ось — 1235

Полная масса ГАЗ-69А, кг — 1960

#i В том числе на переднюю ось — 925 #i В том числе на заднюю ось — 1035

Дорожные просветы под осью, мм:

#i передней — 210 #i задней — 210

Радиус поворота, м:

#i по оси следа внешнего переднего колеса — 6 #i наружный габаритный — 6,5

Максимальная скорость, км/ч — 90 Контрольный расход топлива при скорости 30—40 км/ч, л/100 км — 14 Двигатель М-20М, карбюраторный, четырехтактный, четырёхцилиндровый, расположение цилиндров Вертикальное. Диаметр цилиндра и ход поршня, мм — 88X100 Рабочий объем, л — 2.43 Степень сжатия — 6.5 — 6.7 Максимальная мощность, л. с. — 65 при 3800 об/мин Максимальный крутящий момент, кгс-м 15,2 при 2000 об/мин Карбюратор — Вертикальный, балансированный, с падающим потоком. Имеет экономайзер и ускорительный насос. Напряжение электрооборудования — 12B Аккумуляторная батарея — 6СТ-54 Прерыватель-распределитель — Р-23 Катушка зажигания — Б1 Свечи зажигания — М12У Генератор — Г20 Реле-регулятор — РР24Г Стартер — СТ20 Фары — ФГ2-А2 Сцепление однодисковое сухое Коробка передач — Двухходовая, с 3 передачами вперед и одной назад Главная передача одинарная гипоидная Передаточные числа:

#i коробки передач — I—3,115; II—1,772; III-1.00; З.Х.—3.738 #i раздаточной коробки I—1,15; II—2,78; #i главной передачи — 5,125

Рулевой механизм глобоидальный червяк с двойным роликом. Передаточное число — 18,2 Подвеска:

#i Рессорная, на 4 продольных полуэллиптических рессорах, работающих совместно с 4 гидравлическими поршневыми амортизаторами двухстороннего действия.

Тормоза:

#i рабочий Колодочные на все 4 колеса; привод гидравлический от педали. #i стояночный колодочный с барабаном. Привод механический, тросовый от рычага.

Число колес — 4+1 Размер шин — 6,50 — 16 Давление воздуха в шинах:

#i передних колес, кгс/см2 — 2 #i задних колес, кгс/см2 — 2.2

Заправочные объемы, л, и рекомендуемые эксплуатационные материалы:

#i ГАЗ-69 Основной топливный бак — 48 л., дополнительный бак — 27 л. #i ГАЗ-69А (один) топливный бак — 60 л.

Габаритные размеры

Контрольно-измерительные приборы и органы управления

1 — рулевое колесо, 2 — защелка рамы ветрового окна, 3 — кнопка сигнала, 4 — рукоятка жалюзи радиатора, 5 — щиток приборов, 6 — рычаг люка вентиляции, 7 — кнопка предохранителя освещения, 8 — зеркало, 9 — выключатель освещения приборов, 10 — включатель стеклоочистителя, 11 — противосолнечный щиток, 12 — выключатель фонаря освещения, 13 — направляющие обдува ветрового окна, 14 — фонарь освещения, 15 — кулиса ветрового окна, 16 — отопитель, 17 — рычаг тормоза, 18 — рычаг переключения передач, 19 — педаль стартера, 20 — рычаг раздаточной коробки, 21 — рычаг выключения переднего моста, 22 — педаль акселератора, 23 — трехходовой кран топливного бака (на автомобиле ГАЗ-69А не ставился), 24 — педаль тормоза, 25 — педаль сцепления, 26 — кнопка ножного переключателя света, 27 — включатель поворотной фары, 28 — блок плавких предохранителей, 29 — штепсельная розетка, 30 — центральный переключатель света, 31 — указатель уровня бензина, 32 — контрольная лампа температуры воды, 33 — манометр, 34 — лампа освещения приборов, 35 — спидометр, 36 — термометр, 37 — индикатор дальнего света, 38 — амперметр, 39 — замок зажигания, 40 — включатель освещения приборов, 41 — кнопка подсоса, 42 — кнопка ручного управления дросселем, 43 — включатель вентилятора обдува ветрового стекла.

Кузов автомобиля ГАЗ-69, модель „76″

Кузов автомобиля ГАЗ-69A, модель „77″

1 — передняя правая дверь, 2 — передние сиденья, 3 — задняя левая дверь, 4 — заднее сиде-нье, 5 — тент в сложенном положении, 6 — ветровое окно, 7 — кулиса ветрового окна, 8 — поворотная лампа-фара, 9 — застежка крепления рамы ветрового окна.

Шасси автомобиля ГАЗ-69А

Источники информации:

#i АВТОМОБИЛИ ГАЗ-69 и ГАЗ-69А. «Горьковское книжное издательство» 1956. #i АВТОМОБИЛИ ГАЗ-69 и ГАЗ-69А ИНСТРУКЦИЯ ПО УХОДУ. «Ульяновский автомобильный завод» 1962. Издание одинадцатое. #i Журнал «Моделист-Конструктор» 1977, №2 (OCR: mkmagazin.almanacwhf.ru) #i Лучший неофициальный сайт журнала «Моделист-Конструктор» (Очень рекомендую посетить!) #i Самый лучший сайт посвящённый ГАЗ-69 (Очень рекомендую посетить!)

 

технические характеристики автомобиля, максимальная комплектация, история создания, расход топлива

Внедорожник ГАЗ-69, созданный в послевоенные годы, на долгое время стал основным автомобилем для армии и милиции. Конструкция «козлика» позволяла вести эксплуатацию на дорогах любого типа и работать на бензине низкого качества. Машина не потеряла актуальности и сегодня. Одни энтузиасты восстанавливают внедорожники до заводского состояния, а другие – строят на базе ГАЗ-69 экспедиционные джипы, способные двигаться по тяжелому бездорожью.

Несмотря на то, что данный автомобиль выпускался довольно давно, и только 19 лет (1953…1972), он и сейчас кое-где в строю. Его можно встретить и в тайге и в горных склонах Кавказа, пусть потрёпанные, но не потерявшие боевого духа машины выполняют свою работу.

История создания

Разработка нового легкового внедорожника для армии и гражданской службы началась на ГАЗ в 1946 году под руководством Г.М. Вассермана. Для ускорения работ и удешевления производства в конструкции автомобиля применялись унифицированные узлы. Первоначально вездеход имел обозначение «Труженик». Техническое задание предусматривало работу автомобиля совместно с прицепом весом до 800 кг.

Первые прототипы появились в 1948 году, а серийное производство началось спустя пять лет. Машина выпускалась в Горьком до 1956 года, затем всю оснастку постепенно передали в Ульяновск – на завод УльЗиС.

На протяжении двух лет выпуск внедорожников велся одновременно на двух производственных площадках. После окончательного освоения производства завод в Ульяновске переименовали в УАЗ, а машины в УАЗ-69 и УАЗ-69А соответственно.

Выпуск внедорожников продолжался до 1972 года и был прекращен после сборки более чем 634 тыс. машин.

Конструкция

Основой внедорожника является рама сложной формы с лонжеронами замкнутого профиля. Для увеличения жесткости рама оснащена дополнительными поперечинами. Подвески мостов рессорные, оснащены рычажными амортизаторами.

Картеры мостов разъемные по вертикальному фланцу. Чулки запрессованы в половины и дополнительно зафиксированы заклепками.

Двигатель

Внедорожник ГаЗ-69 первых выпусков комплектовался 4-цилиндровым бензиновым двигателем мощностью 52 л.с. Двигатель унифицирован с агрегатом от ГаЗ-М20 «Победа». В качестве топлива использовался бензин с октановым числом не ниже А66.

Кузов ГАЗ-69 модель 76

Кузов открытого типа, рассчитан на 8 человек. Водитель и передний пассажир располагаются на отдельных сидениях переднего ряда. Места оборудованы индивидуальными дверями не симметричной формы.

Водительская дверь имеет форму трапеции из-за установки запасного колеса на боковине кузова.

Шесть человек размещаются в задней части кузова на двух откидных лавках. Под лавками имеются металлические ящики, предназначенные для хранения инструмента и запасных частей.

Кузов вездехода позволяет перевозить одного раненого на носилках, закрепляемых на поручне приборной панели и заднем борту. Спинка пассажирского сидения складывается вперед и не мешает установке носилок. Сопровождающее лицо размещается на лавке левого борта.

Вездеходы ГАЗ-69А оснащены двумя топливными баками.

Основной бак вмещает 47 л бензина и расположен между лонжеронов рамы, под полом кузова. Дополнительный бак на 28 л установлен под сидением переднего пассажира. Баки соединены между собой топливопроводами.

Кузов ГАЗ-69А модель 77

Вездеход ГАЗ-69А оснащен металлическим открытым кузовом с 4 дверями. В салоне расположены два ряда сидений – для водителя и пассажира спереди и для 3 пассажиров сзади. Задний ряд сидений мог складываться.

Задний борт унифицирован, внутренний объем используется для хранения буксировочного троса и других предметов инвентаря. Машина оснащена топливным баком емкостью 60 л, установленным в кормовой части кузова.

Шасси ГАЗ-69А

Основой вездехода является рама сложной геометрической формы. Боковые лонжероны выполнены штамповкой из листовой стали. Для увеличения жесткости на кручение рама оснащена дополнительными поперечинами.

К раме крепятся листовые рессоры подвесок переднего и заднего мостов. Каждый мост дополнительно укомплектован двумя рычажными амортизаторами. Картеры мостов состоят из двух половин, размыкаемых по вертикальному фланцу. Чулки полуосей запрессованы в половины картера и дополнительно зафиксированы заклепками.

Приборы

Вездеходы ГАЗ-69 и 69А оснащены одинаковой панелью приборов, на которой установлены указатель скорости, амперметр, индикатор количества топлива в баке, указатель температуры двигателя и манометр системы смазки.

Комбинация приборов оснащена двумя лампами подсветки, закрытыми металлическими рассеивателями света.

Кроме приборов имеется две контрольные лампы – дальнего света фар (красная) и перегрева двигателя (зеленая).

Тормозная система

Вездеход ГАЗ-69 оснащен тормозной системой с гидравлическим приводом колодок. Механизмы барабанного типа, расположены на ступицах колес. Барабаны отлиты из чугуна, рабочая часть состоит из стального кольца, залитого в тело детали.

На стоянках автомобиль удерживается дополнительным барабанным механизмом с тросовым приводом от места водителя. Механизм установлен на выходном валу раздаточного редуктора.

Рулевое управление

Рулевая колонка вездеходов ГАЗ-69 и 69А расположена на левой стороне. Колонка жестко установлена на кузове, внутри на подшипниках расположен вал, соединенный редуктором. Вал вращает глобоидальный червяк, по которому движется двойной ролик, связанный с сошкой.

Поворот колес выполняется тягами трубчатой конструкции, расположенными впереди моста. Рулевое колесо 3-спицевое, изготовлено из пластика черного цвета.

Модернизации

Основным заказчиком внедорожников выступало Министерство обороны СССР, поэтому машины практически не изменялись в процессе производства. Единственную модернизацию провели в начале 1970 года. Изменения коснулись остекления тента, внедрили два цилиндра в передних тормозных механизмах.

Мосты оснастили усиленными дифференциалами, в электрической системе ввели выключатель «массы».

Самым заметным изменением стала возможность отключения привода передних колес. Модернизированные внедорожники получили обозначения УАЗ-69-68 и 69А-68 (или 69М и 69АМ).

Технические характеристики ГАЗ-69 и 69А

 М151ГАЗ-69ГАЗ-69А
СтранаСШАСССР
Длина, мм33803850
Ширина со снятым/установленным запасным колесом, мм16301750/1850
Высота (с тентом), мм180020301920
Наибольшая скорость, км/ч11290
Расход бензина (средний), л/100 км1214
Вместимость, чел + грузоподъемность, кг4 + 360 или
2+ 544
8+0
или 2+500
5+50
Мощность двигателя, л.с.7255

Применение

Автомобили ГАЗ-69 и 69А в течение 20 лет являлись основными легкими внедорожниками в Советской Армии и войсках стран Варшавского договора. Автомобили применялись для перевозки личного состава и в качестве тягачей для легких артиллерийских систем весом до 800 кг.

На базе армейских внедорожников создавались специальные установки, например, передвижные радиостанции или автомобили химической разведки. На машинах устанавливались пусковые установки противотанковых ракет. Одной из известных модификаций ГАЗ-69 является боевая машина 2П26 ПТРК «Шмель».

Для десантных частей поставлялись внедорожники со снятой рамой ветрового стекла и с демонтированными выступающими внешними элементами. Внедорожник ГАЗ-69 явился основой для плавающей машины ГАЗ-46.

На аэродромах ГАЗ-69 использовались в качестве перевозчика стартерного комплекса АПА-12, предназначенного для запуска турбореактивных двигателей.

Гражданские внедорожники ГАЗ-69 были популярны в качестве патрульных автомобилей милиции и ГАИ.

Машины часто лишались тента, вместо которого устанавливался металлический верх. Работы выполнялись на провинциальных авторемонтных заводах. В частное владение автомобили попадали только после списания из государственных учреждений.

Нужно отметить, что большую популярность автомашины ГАЗ-69 получили на Кавказе и в Сибири, где они повсеместно использовались как вездеходы. Элементы шасси ГАЗ-69 использовались в конструкции ГАЗ-М72 – оригинального полноприводного автомобиля на базе кузова «Победа». Внедорожник выпускался в Румынии на заводе ARO до 1975 года.

Видео

объем двигателя, размеры рамы и кузова, максимальная скорость), фото лифтинга ⭐ doblest.club

В послевоенное время, в Советском Союзе началось масштабное восстановление инфраструктуры, и именно в этот момент не хватало автомобиля, который мог бы с легкостью передвигаться как по асфальтным, так и по проселочным дорогам.

Именно по этим причинам в 1946 году началась разработка Газ 69, который должен был иметь мощную колесную базу, простую конструкцию и низкую стоимость. И только через 8 лет с конвейера сошли первые модели, прошедшие все испытания и служившие многие годы на благо Отечества.

ГАЗ 69

Технические характеристики

Размеры кузова ГАЗ 69: длина/ширина/высота в мм. 3850/1750/2000
Вес в кг. 1500
Колесная база в мм. 2300
Колея передняя/задняя в мм. 1440
Мощность в л.с. 55
Объем двигателя ГАЗ 69 в л. 2,12
Максимальная скорость в км/ч 90

История создания ГАЗ 69 «Труженика»

Дата Событие
1946 г. Начало работы над проектом
1948 г. Создание первых 3 прототипов и начало прохождение испытаний
1953 г. Запуск конвейерного производства на заводе ГАЗ
1956 г. Перенос производства на завод УАЗ и сбор двух модификаций (2х дверной и 5и дверной). Экспорт автомобиля в 52 страны.
1957 г. Запуск производства автомобилей ГАЗ 69 в Румынии
1962 г. Запуск производства автомобилей ГАЗ 69 в Северной Корее
1972 г. Остановка производства.

Первые три опытных образца ГАЗ 69 появились в 1948 году, после чего начались их испытания, в которых автомобиль прекрасно справлялся с любыми задачами. На конвейерное производство автомобиль был поставлен в 1953 году, после чего получил прозвище «Труженик».

Смотрите также статью Газ 33081 «Егерь» и его технические характеристики

Основой для 69 модели являлся ГАЗ 67, который активно эксплуатировался во время Второй мировой войны. В конструкции нового ГАЗ 69 использовались запчасти других производителей автомобилей, что значительно упростило производство и стоимость.

Вопреки заблуждениям, дизельный ГАЗ 69 никогда не выпускался в заводских условиях. Таким вездеход стал в результате тюнинга владельцами легендарных машин.

ГАЗ 69 1953 года выпуска

В 1956 году было решено перенести производство из завода ГАЗ на УАЗ и выпускать автомобиль в нескольких модификациях — двух дверной и пяти дверной.

После запуска производства автомобиль был высоко оценен зарубежными инженерами по всем характеристикам, по которым ГАЗ превосходил своих конкурентов — Jeep и Land Rover. После чего автомобиль начал экспортироваться в более чем 50 стран мира. Далее было налажено производство в Румынии и Северное Корее.

Северная Корея ГАЗ 69 (наши дни)

Тактико-технические характеристики

Длина/Ширина/Высота в мм. 3850/1750/2000
Колесная база в мм. 2300
Колея передняя/задняя в мм. 1440
Дорожный просвет в мм. 210
Вес в кг. 1500
Трансмиссия 3х ступенчатая механика
Колесная база 4х4
Тип двигателя карбюраторный
Мощность в л.с. 55
Объем двигателя в л. 2,1
Число цилиндров 4
Максимальная скорость в км/ч 90
Объем топливного бака в л. 70
Грузоподъемность 2 чел. или 8 чел. и 50 кг.

Конструкция

Автомобиль ГАЗ 69 имеет съемную крышу из брезентового тента, которая крепится к металлическому каркасу. По такому же принципу крепится тент на боковые двери.

Система отопления салона подавалась на лобовое стекло через вентилятор, в салон теплый воздух поступал через подкапотные воздухозаборники, что для зимнего периода эксплуатации являлось незначительным.

Летний период эксплуатации можно было легко охладить автомобиль с помощью съемных частей, которых в 69 модели достаточно много.

Смотрите также статью Модель ГАЗель Некст и её технические характеристики

В целом, салон выполнен в простом для советского времени стиле. На приборной панели было установлено всего три датчика:

  • спидометр;
  • топливо;
  • амперметр.
Салон «Труженика»

Кузов «Труженика» мог вместить до восьми человек. Водитель и пассажир на передних сиденьях, три пассажира на заднем сиденье, и три пассажира на месте, прикрепляемом за задним сиденьем.

В модификации ГАЗ 69А кузов позволял перевозить до 5 пассажиров, остальное место было переделано под груз. ГАЗ 69 имел два топливных бака, на 48 и 12 литров, а технические характеристики 69А свидетельствуют только об одном, емкостью на 60 литров.

Смотрите также статью Грузовой автомобиль ГАЗ-3309 и его история

Лифтинг ГАЗ 69

Часто владельцы «Труженика» увеличивали показатели проходимости за счет установки больших колес и лифтинга подвески. Такие изменения проводятся во время тюнинга. Лифтинг ГАЗ 69 являет собой увеличение дорожного просвета за счет поднятия подвески. Но такое улучшение увеличивало риск переворота на поворотах.

Фото лифтинга ГАЗ69

Рама ГАЗ 69

ГАЗ 69 получил мощную короткую раму, которая была создана по опыту предыдущей модели. Она могла выдерживать колоссальные нагрузки и поддавалась множеству модификаций. Рама ГАЗ 69 настолько крепкая, что выдержала эксплуатацию до наших дней без ремонта.

Рама ГАЗ 69 (фото с двигателем)

Трансмиссия

Множество деталей было позаимствовано у других автомобилей, что сделало ГАЗ 69 таким, какой он есть. Трехступенчатая механическая коробка передач была взята у ГАЗ М20 «Победа». Рулевой механизм позаимствован из предыдущей 67й модели.

Устанавливалось два топливных бака, первый на 48 литров — под капотом, второй на 27 литров — под водительским сидением. Дальнейшие модификации имели только один общий бак.

Проходимость

Главным достижением «Труженика» являлась проходимость, которая на тот момент была на порядок выше предыдущей модели и зарубежных аналогов. Максимальная скорость ГАЗ 69 по грунту составляла 45 км/ч, а по шоссе 90 км/ч.

Благодаря уникальной компоновке подвески, автомобиль может преодолевать грязевой слой до 40 см и уклоны до 38°. Такие данные и сегодня делают ГАЗ 69 серьезным внедорожником.

ГАЗ 69А на болотистой местности

Модификации

 

 

Внешний вид Описание

ГАЗ 69А

Модификация имела 4 двери, 5 мест. и большой багажник

Длина/Ширина/Высота в мм. — 3850/1750/2000

Вес в кг.- 1500

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,12

Максимальная скорость в км/ч — 90

ГАЗ 69-68

Модификация получила 2 двери, 8 мест и откидной борт

Длина/Ширина/Высота в мм. — 3850/1750/2000

Вес в кг.- 1500

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,12

Максимальная скорость в км/ч — 90

ГАЗ 69Э

К базовой комплектации было добавлено экранированное оборудование

Длина/Ширина/Высота в мм. — 3850/1750/2000

Вес в кг.- 1600

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,12

Максимальная скорость в км/ч — 90

ГАЗ 69М

Модель изготовлялась для экспорта и имела более мощный 2,5 л. двигатель ГАЗ 69

Длина/Ширина/Высота в мм. — 3850/1750/2000

Вес в кг.- 1600

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 75

Объем двигателя в л.- 2,5

Максимальная скорость в км/ч — 100

ГАЗ 69П

Данный вариант изготавливался для милиции

Длина/Ширина/Высота в мм. — 3850/1750/2200

Вес в кг.- 1700

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,5

Максимальная скорость в км/ч — 90

ГАЗ 69Б

Модель была изготовлена для транспортировки почты и работы в сельскохозяйственной сфере

Длина/Ширина/Высота в мм. — 3850/1750/2200

Вес в кг.- 1800

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,5

Максимальная скорость в км/ч

ГАЗ 69 ЛСД

Модификация была разработана для медицины и ветеринарии

Длина/Ширина/Высота в мм. — 3850/1750/2200

Вес в кг.- 1800

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,12

Максимальная скорость в км/ч — 90

ГАЗ 69 ДИМ

ДИМ был выпущен специально для саперных служб, на автомобиль крепился индукционный миноискатель

Длина/Ширина/Высота в мм. — 3850/1750/2200

Вес в кг.- 1900

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,12

Максимальная скорость в км/ч — 90

ГАЗ 69А Шмель

На двухместную машину устанавливался ракетный комплекс «Шмель». Размеры кузова ГАЗ 69 оказались идеальными для монтажа установки

Длина/Ширина/Высота в мм. — 3850/1750/2400

Вес в кг.- 2200

Колесная база в мм.- 2300

Колея передняя/задняя в мм.- 1440

Мощность в л.с.- 55

Объем двигателя в л.- 2,12

Максимальная скорость в км/ч — 70

Достоинства и недостатки

Несмотря на то, что автомобиль был выпущен еще 60 лет назад, он все еще пользуется большим спросом у автомобилистов. Основой упор в ГАЗ 69 был сделан на большую проходимость, простоту конструкции и последующей эксплуатации.

Достоинства:

  • простая конструкция;
  • недорогое обслуживание;
  • универсальность;
  • мощная тяга на нижнем ряду;
  • не привередливость к маслу и топливу;
  • большая проходимость.

Недостатки:

  • тяжелые тормоза;
  • слабый двигатель;
  • малый обзор при установленном тенте;
  • малая мощность системы отопления;
  • отсутствие шумоизоляции.

Интересные факты

  • ГАЗ 69 часто можно увидеть не только в советских, но и в зарубежных фильмах. В 2006 году в фильме «Письмо с Иводзимы» он использовался как японский внедорожник времен второй мировой войны.
Кадр из фильма «Письмо с Иводзимы»
  • Существовало множество модификаций, которые предусматривали даже установку ракетного комплекса.
  • Группа итальянских путешественников провела двух годовое путешествие по Африке на ГАЗ 69.
  • В 60х годах в СССР не существовало специальной охладительной жидкости, поэтому активно применялась обычная вода. В зимний период, утром водители заливали воду, а вечером сливали.
  • Иногда ГАЗ 69 из-за жесткой подвески называли «Козликом».
  • Автомобиль можно увидеть в видеоиграх, таких как Батлфилд и Медаль за отвагу.
Тюнингованный Газ 69 в компьютерной игре
  • ГАЗ 69 является излюбленным автомобилем для тюнинга, и на данный момент очень сложно найти стоковый вариант.
ГАЗ 69 в тюнинге

69 — это… Что такое ГАЗ-69?

ГАЗ-69
ГАЗ-69А

Общие данные

ГАЗ-69
Производитель: ГАЗ
Марка: ГАЗ-69
Тип: карбюраторный
Объём: 2120 см3
Максимальная мощность: 55 л.с., при 3600 об/мин
Максимальный крутящий момент: 127 Н·м, при 2000 об/мин
Конфигурация: рядный, 4-цилиндр.
Цилиндров: 4
Клапанов: 8
Макс. скорость: 90 км/час
Расход топлива при смешанном цикле: 14 л/100 км
Диаметр цилиндра: 82 мм
Ход поршня: 100 мм
Cтепень сжатия: 6,5
Система питания: Карбюратор К-22Д
Охлаждение: жидкостное
Клапанной механизм: нижний
Материал блока цилиндров: серый чугун
Материал ГБЦ (англ.)русск.: Алюминий
Тактность (число тактов): 4
Порядок работы цилиндров: 1-2-4-3
Рекомендованное топливо: 66

механическая, трёхступенчатая, с двухступенчатой раздаточной коробкой

Характеристики

Массово-габаритные

Ширина: 1750 мм (со снятым запасным колесом)
Высота: 2030 мм (ГАЗ-69А — 1920 мм)
Колея задняя: 1440 мм
Колея передняя: 1440 мм
Масса: 1535 кг (в снаряженном состоянии)

Динамические

Макс. скорость: 90 км/ч

На рынке

Предшественник

Предшественник

Преемник

Преемник
Связанные: IMS-57
ARO-M461

Другое

Грузоподъёмность: 8 человек или 2 человека и 500 кг груза.
Расход топлива: 14
Объём бака: 48+27 л (ГАЗ-69А — 60 л)
Дизайнер: Б. Н. Панкратов

ГАЗ-69 (ГАЗ-69А) («Козлик», «Газик») — советский легковой автомобиль повышенной проходимости. Производился с 1951 по 1972 год.

История

Создан коллективом конструкторов Горьковского автомобильного завода (Ф. А. Лепендин, Г. К. Шнейдер, Б. Н. Панкратов, С. Г. Зислин, В. Ф. Филюков, В. И. Подольский, В. С. Соловьёв, под руководством Г. М. Вассермана) на замену модели ГАЗ-67Б. Разработки автомобиля начались в 1946 году, опытные образцы изготавливались с 1948 года. Первые опытные образцы носили название «Труженик».

Серийный выпуск начат 25 августа 1953 г. Выпускался на ГАЗе до 1956 года, позже производство было полностью передано в Ульяновск — на бывший УльЗиС, в войну собиравший грузовики ЗИС-5В, а в конце 1940-х — полуторку ГАЗ-ММ-В. С началом производства ГАЗ-69 предприятие было переименовано в Ульяновский автомобильный завод (УАЗ). Как и предыдущие горьковские «джипы» (ГАЗ-64, ГАЗ-67, ГАЗ-67Б), ГАЗ-69 в народе назывался «козликом».

ГАЗ-69А

С самого начала новая машина выпускалась в двух модификациях: ГАЗ-69 с двухдверным восьмиместным кузовом (шесть человек на продольных трёхместных лавках, откидной задний борт) и сельскохозяйственный (командирский) ГАЗ-69А с четырёхдверным пятиместным кузовом с комфортабельным трёхместным задним сиденьем. Производство семейства ГАЗ-69 Горьковский завод начал в 1953 году, причём параллельно (с декабря 1954 года) эти вездеходы собирал и Ульяновский автозавод. Полностью на выпуск ГАЗ-69 и ГАЗ-69А из узлов собственного производства УАЗ перешёл после 1956 года.

На базе ходовой части ГАЗ-69 и усиленного несущего кузова «Победы» Горьковский завод с середины 1955 года освоил выпуск оригинального легкового полноприводного автомобиля ГАЗ-М-72. Кроме того, на агрегатах ГАЗ-69 завод выпускал с 1952 года малую амфибию ГАЗ-46 (МАВ). В 1970 году на УАЗе был освоен модернизированный вариант ГАЗ-69-68 с мостами от грузовика УАЗ-452. На ГАЗ-69 базировалась также противотанковая реактивная установка 2П26 для пуска 4 управляемых ракет (ПТУР) комплекса 2К15 «Шмель». На базе полноприводного ГАЗ-69 был создан опытный образец фургона ГАЗ-19 с колёсной формулой 4×2 для обслуживания почтовых учреждений.

Двигатель, трансмиссия

Об устройстве рядных шести- и четырёхцилиндровых двигателей Горьковского автозавода см. статью ГАЗ-11 (двигатель).

  • Тип двигателя — 4-тактный, бензиновый, карбюраторный.
  • Количество цилиндров — 4.
  • Диаметр цилиндра и ход поршня, мм — 82×100
  • Рабочий объём цилиндров — 2,12 л.
  • Степень сжатия — 6,2—6,5.
  • Максимальная мощность — 55 л. с. при 3600 об/мин.
  • Максимальный крутящий момент — 12,7 кгм при 2000 об/мин.
  • Воздухоочиститель инерционно-масляный, в системе смазки два фильтра — грубой очистки полнопоточный щелевой с отстойником (пакет из металлических дисков с зазорами, принудительная очиска зазоров проворачиванием ротора вручную) и фильтр тонкой очистки со сменным элементом ДАСФО (картонный двухсекционный автомобильный супер-фильтр-отстойник), работал только на слив масла в картер.
  • Сцепление сухое, однодисковое.
  • Коробка передач двухходовая, с тремя передачами вперёд и одной назад. Передаточные числа: 1-я передача — 3,115; 2-я передача — 1,772; 3-я передача — 1,000; задний ход — 3,738.
  • Раздаточная коробка шестерёнчатая, имеет две передачи с передаточными числами 1,15 и 2,78. Низшая передача (2,78) может быть включена только после включения переднего моста.
  • Карданных валов три: промежуточный (между КПП и раздаточной коробкой), задний и передний.
  • Главная передача одинарная коническая, со спиральным зубом. Передаточное число главной передачи переднего и заднего мостов — 5,125. Полуоси полностью разгруженные.

Технические характеристики

ГАЗ-69А со снятым тентом, современная покраска ГАЗ-69А
Длина 3850 мм
Ширина 1750 мм
Высота 2030 мм
Колёсная база 2300 мм
Передний угол свеса 45
Задний угол свеса 35
Масса 1525 кг
Скорость 90 км/ч
Макс. мощность при 3700 об./мин 55 л.с.
Макс. крутящий момент 12,7 кг·м
Число цилиндров 4
Объём двигателя 2,12 л
Передачи три переднего хода, одна заднего
Передаточные числа 1 — 3,115
2 — 1,772
3 — 1,00
задний ход — 3,738
Размер шин 6,50-16
Запас топлива 48 л главный бак
27 л дополнительный бак (на ГАЗ-69А один бак на 60 л)
ГАЗ-69, место водителя «Салон» автомобиля ГАЗ-69

Интересные факты

  • Автомобиль ГАЗ-69 в роли японского военного внедорожника участвует в некоторых сценах известного фильма Клинта Иствуда «Письма с Иводзимы» (2006 г). Сцены относятся к событиям 1944-45 гг. на японском острове Ио.
  • За два десятилетия производства ГАЗ-69 и ГАЗ-69А было выпущено свыше 600 тысяч машин. ГАЗ-69 экспортировался в 56 стран мира в разных климатических исполнениях (ГАЗ-69М и ГАЗ-69АМ), кроме того, в 1957 году техническая документация на массовое производство была передана в Румынскую компанию ARO, а в 1962 году — в Северную Корею.[1]
  • Различными авторемонтными заводами и структурами МВД СССР автомобиль дорабатывался путем снятия тента и установки цельнометаллической крыши.
  • Под капотом на левой стороне двигателя монтировался котёл предпускового подогрева. В зимнее время необходимо было вывернуть руль вправо, в крыле левого переднего колеса открыть люк и в жаровую трубу котла вставить работающую паяльную лампу. Прогревалась жидкость в системе охлаждения, горячими газами согревалось моторное масло в поддоне картера. При подогреве «сухого» двигателя в котёл заливалось 5 литров воды, затем следовал подогрев образующимся паром. Затем — запуск двигателя и долив воды в радиатор.
  • Расположенный в салоне отопитель подавал при помощи электрического вентилятора тёплый воздух только на ветровое стекло. К ногам водителя и пассажира тёплый воздух поступал только при движении автомобиля через открывающийся за капотом воздухозаборник. Зимой в салоне стоящего автомобиля было холодно. Боковые панели облицовки капота были съёмные, летом это значительно облегчало охлаждение двигателя. Поднимающиеся вперёд-вверх рамки ветрового стекла делала поездку нежаркой («с ветерком» и с соответствующим количеством дорожной пыли). При сложенном тенте ветровое стекло полностью откидывалось на кронштейны капота и фиксировалось крюками. Верхние боковины дверей съёмные брезентовые на металлических дугах (со стёклами). ГАЗ-69 рассчитан на перевозку раненого на санитарных носилках. Спинка переднего пассажирского сиденья откидывается вперёд, носилки устанавливаются на крепления на пассажирском поручне и на заднем борту автомобиля. Сопровождающий медработник располагается на боковой левой лавке.
  • Для обслуживания и ремонта раздаточной коробки и КПП необходимо снять пол в салоне. Агрегаты для ремонта извлекались в салон.
  • На ГАЗ-69А один топливный бак, на ГАЗ-69 — два. На раме находился фильтр грубой очистки топлива (с отстойником). Фильтр тонкой очистки топлива — на бензонасосе. Померить уровень бензина в основном топливном баке автомобиля ГАЗ-69 водитель мог не вставая с места (щуп рядом с рычагом КПП). На ГАЗ-69 устанавливался и дополнительный топливный бак — под пассажирским сиденьем. Заправка — при открытой пассажирской двери. На панели приборов датчик показывал количество топлива только в основном баке. Узнать, сколько бензина в дополнительном баке можно только посмотрев в заправочную горловину. Переключатель топливных баков — на полу водительского места.
  • Автомобили ГАЗ-69 и ГАЗ-69А встречаются и сегодня. Некоторые, снятые с консервации СА, автомобили часто переделывают для участия в кроссах и триале.
  • Упоминается в книге А. и Б. Стругацких «Понедельник начинается в субботу»: «…если уж покупать что-нибудь, так это „ГАЗ-69“, вездеход, но их, к сожалению, не продают.»

ГАЗ-69 и ГАЗ-69А в кино

В игровой и сувенирной индустрии

ГАЗ-69 на Автофоруме-2007 в Нижнем Новгороде

Масштабные модели ГАЗ-69-69А в масштабе 1:43 в промышленном масштабе в СССР, России, Украине не производились, кроме пластикового ГАЗ-69 в Херсоне на заводе «Электроприбор».

Также ГАЗ-69/69А в масштабе 1:43 выпускался мелкосерийно несколькими фирмами: «Уральский сокол» (Екатеринбург), белгородской мастерской FV Models Cars, Херсонским электромашиностроительным заводом, «Вектор-моделс» (Херсон), мастерской ALF(Николаев).

В рамках журнальной серии «Автолегенды СССР» от издательства DeAgostini можно приобрести ГАЗ-69 и ГАЗ-69А цвета хаки. Кроме того, модели ГАЗ-69 с тентом и ГАЗ-69А в открытом и закрытом вариантах произведены китайской фирмой «Hongwell Toys Limited» по заказу торговой марки «Наш Автопром», по относительно доступным ценам.(ООО «Феран»). Также в рамках журнальной серии Автомобиль на службе можно приобрести ПМГ-20 на базе ГАЗ-69.

Сборные модели ГАЗ-69 и ГАЗ-69А, а также боевая машина 2П26 ПТРК «Шмель» в масштабе 1:35 выпускаются китайской фирмой «Bronco Models».

  • В игре Battlefield: Bad Company 2 Vietnam используется Вьетнамом.
  • В игре Soldiers of Anarchy представлены обе модификации (ГАЗ-69 и ГАЗ-69А обозначены как «ГАЗ» и «ГАЗ-А» соответственно).

Литература

  • Автомобили ГАЗ-69 и ГАЗ-69А. Инструкция по эксплуатации. Издание одиннадцатое. г. Ульяновск, 1962 г.

Примечания

См. также

Ссылки

Газ-69 — Технические характеристики

 

   Газ-69 — Технические характеристики


Технические характеристики Газ-69

Данная информация собрана, опираясь на характеристики серийно-выпускаемых автомобилей.

Марка двигателя: М20
Тип двигателя: рядный, 4-тактный, бензиновый, карбюраторный
Карбюратор: К-22Д
Количество цилиндров: 4
Количество клапанов: 8
Диаметр цилиндра и ход поршня, мм: 82×100
Порядок работы цилиндров Газ-69: 1-2-4-3
Рабочий объём цилиндров: 2,12 л.
Охлаждение: жидкостное
Степень сжатия: 6,2—6,5
Максимальная мощность: 55 л. с. при 3600 об/мин.
Максимальный крутящий момент: 12,7 кгм при 2000 об/мин.
Максимальная скорость Газ-69: 90 км/час
Расход топлива Газ-69 при смешанном цикле: 14 л/100 км
Материал блока цилиндров: серый чугун
Материал ГБЦ: алюминий


Габаритные размеры, масса Газ-69

Длина — 3850 мм
Ширина — 1750 мм
Высота — 2030 мм
Колёсная база — 2300 мм
Передний угол свеса — 45
Задний угол свеса — 35
Колея задняя — 1440 мм
Колея передняя — 1440 мм
Масса — 1525 кг

Габаритный чертеж Газ-69

 

include»inc_foot.php»; ?>

Тулий — информация об элементе, свойства и использование

Стенограмма:

Химия в ее стихии: тулий

(Промо)

Вы слушаете Химию в ее стихии, представленную вам Chemistry World , журналом Королевского химического общества.

(Конец промо)

Мира Сентилингам

Стихия этой недели перенесет нас в неизвестность, в темные, таинственные земли.

Брайан Клегг

В средние века, когда карты были украшены странными и экзотическими неизвестными, где на углах можно было написать «Здесь монстры», самое отдаленное место, которое можно было представить, лежащее за пределами известного мире, был помечен как «Ultima Thule». Thule иногда произносится как Tooli, хотя выглядит так, как будто это должно быть Thool, что, честно говоря, звучит гораздо более уместно, мрачно и таинственно. Первоначально это было классическое название таинственной земли, находящейся в шести днях пути к северу от Британии, которую греческий историк Полибий считал самой северной частью мира.Ultima Thule пошла еще дальше — это была самая дальняя часть Туле.

Когда в 1879 году Пер Теодор Клив назвал тулий, это произошло из-за небольшого непонимания значения слова туле. В конце концов Клив открыл в общей сложности четыре элемента и получил медаль Дэви от Королевского общества за свою работу по редкоземельным металлам, но здесь он был не совсем точен. Он написал: «Для оксида, помещенного между иттербией и эрбией. Я предлагаю название туллия, происходящее от Туле, древнего названия Скандинавии.Он не только перепутал Thule, он даже не мог написать его правильно, поставив две буквы L в названии, но сегодня мы пишем thulium, как и Thule, с одной буквой L. полоса элементов в периодической таблице, которая занимает место между барием и лютецием, тулий имеет атомный номер 69. Это один из редкоземельных элементов, которые часто называют неправильно, поскольку они довольно распространены. Название отражает редкость исходной руды, в которой они были найдены, но в случае с тулием это не такое уж плохое название, поскольку этот мягкий серебристый металл является одним из самых редких редкоземельных элементов и более ценным, чем платина.

Первоначальное открытие элемента было чем-то вроде случайности. Следы эрбия и тербия были обнаружены, когда иттрий был впервые обнаружен, хотя изначально не осознавалось, что они сами по себе являются новыми элементами. Клив исследовал оксид эрбия, выделенный из смеси, и обнаружил, что он тоже испорчен. В нем было небольшое количество неизвестного вещества, которое давало небольшое изменение атомного веса. Все более тонкое разделение содержимого этой продуктивной руды в конечном итоге привело бы к получению оксидов еще двух элементов — гольмия и, наконец, тулия.

Тулий долгое время был веществом Золушки. Не было ничего, что можно было бы сделать с тулием, чего нельзя было бы сделать лучше и дешевле с одним из других элементов. Казалось вероятным, что он будет отправлен на свалку бесполезных химических веществ. Примечательно, что один научный писатель сказал о тулии: «Самое удивительное в нем то, что в нем нет ничего удивительного». Но это немного несправедливо.

Тулий не совсем массовый продукт, но ежегодно добывается около 50 тонн его в трех рудных зонах — Австралии и Китае, США и Бразилии, Индии и Шри-Ланке.И это не усилие, которое было бы вложено впустую.

Единственным естественным изотопом тулия, который обычно встречается в виде оксида, является тулий 169. Он стабилен, но тулий 170 с периодом полураспада 128 дней, полученный бомбардировкой тулия в ядерном реакторе, оказался хорошим портативным источником x -лучи. Впервые он был предложен для этой роли в 1950-х годах и с тех пор часто использовался в небольших устройствах, таких как те, которые используются в стоматологических кабинетах. Как источник с низким энергопотреблением, он относительно безопасен, что делает его хорошим выбором для низкотехнологичных приложений, которые также обнаруживают его появление в инженерии, где рентгеновские лучи можно использовать для поиска трещин в компонентах.

Менее распространенная, но все же ценная роль тулия в легировании особого типа граната, иттрий-алюминиевого граната или YAG. Кристалл используется в качестве активной среды в лазере с длиной волны около 2000 нанометров, что идеально подходит для лазерной хирургии, поэтому тулий снова приходит нам на помощь.

Тулий, возможно, не нашел широкого применения, но он внес вклад в Нобелевскую премию американского химика Теодора Уильяма Ричардса. Если когда-либо Нобелевская премия присуждалась исключительно за упорный упорный труд, то это была та, которую получил Ричардс в 1914 году.Нобелевская ссылка должна быть одной из наименее впечатляющих из когда-либо сделанных. Это было «в знак признания его точного определения атомного веса большого количества химических элементов». Но это отражает для одного только тулия в общей сложности 15 000 экспериментов по перекристаллизации, прежде чем Ричардс получил достаточно чистый образец бромата тулия, чтобы быть в состоянии зафиксировать его атомный вес к своему удовлетворению (168,, если быть точным).

Когда Пер Теодор Клив назвал тулий, он работал в Упсальском университете в Швеции, старейшем из скандинавских университетов.Он хотел прославить историческую скандинавскую культуру — и даже если он не совсем правильно позиционировал мифологическую землю, для Клива его новым открытием останется Ultima Thule.

Мира Сентилингам

Переносит нас в дальние страны с помощью элемента, который приходит нам на помощь в виде лазеров и рентгеновских лучей малого масштаба. Это был научный писатель Брайан Клегг с химией тулия. Теперь, на следующей неделе, элемент, которым можно манипулировать, чтобы дать нам то, что мы хотим.

Андреа Селла

Темно-серого цвета, с очень блестящим, как стекло, блеском, он выглядит как металл, но на самом деле является довольно плохим проводником электричества, и во многом именно в этом заключается секрет его превосходных свойств. успех. Преднамеренно вводя примеси, такие как бор или фосфор, можно слегка изменить электрические свойства элемента. Такие приемы лежат в основе функционирования кремниевых чипов, позволяющих слушать этот подкаст. Менее чем за 50 лет кремний превратился из интригующей диковинки в один из самых фундаментальных элементов нашей жизни.

Мира Сентилингам

А чтобы узнать больше о том, насколько важен кремний в нашей повседневной жизни, присоединяйтесь к Андреа Селла на следующей неделе в программе Химия в ее стихии. А пока я Мира Сентилингам, и спасибо, что выслушали.

(Акция)

(Конец акции)

Определение опасных отходов: перечисленные, характерные и смешанные радиологические отходы

P001 1 81-81-2 2H-1-Бензопиран-2-он, 4-гидрокси-3-(3-оксо-1-фенилбутил)- и соли, если они присутствуют в концентрациях выше 0.3%
P001 1 81-81-2 Варфарин и соли, если они присутствуют в концентрациях более 0,3%
P002 591-08-2 Ацетамид, -(аминотиоксометил)-
P002 591-08-2 1-ацетил-2-тиомочевина
P003 107-02-8 Акролеин
P003 107-02-8 2-пропеналь
P004 309-00-2 Олдрин
P004 309-00-2 1,4,5,8-Диметанонафталин, 1,2,3,4,10,10-гексахлор-1,4,4а,5,8,8а,-гексагидро-, (1альфа,4альфа,4абета, 5альфа,8альфа,8абета)-
P005 107-18-6 Спирт аллиловый
P005 107-18-6 2- Пропен-1-ол
P006 20859-73-8 Фосфид алюминия (R,T)
P007 2763-96-4 5-(Аминометил)-3-изоксазолол
P007 2763-96-4 3(2H)-изоксазолон, 5-(аминометил)-
P008 504-24-5 4-аминопиридин
P008 504-24-5 4-пиридинамин
P009 131-74-8 Пикрат аммония (R)
P009 131-74-8 Фенол, 2,4,6-тринитро-аммониевая соль (R)
P010 7778-39-4 Мышьяковая кислота H 3 AsO 4
P011 1303-28-2 Оксид мышьяка As 2 O 5
P011 1303-28-2 Пятиокись мышьяка
P012 1327-53-3 Оксид мышьяка As 2 O 3
P012 1327-53-3 Триоксид мышьяка
P013 542-62-1 Цианид бария
P014 108-98-5 Бензентиол
P014 108-98-5 Тиофенол
P015 7440-41-7 Бериллиевый порошок
P016 542-88-1 Дихлорметиловый эфир
P016 542-88-1 Метан, оксибис[хлор-
P017 598-31-2 Бромацетон
P017 598-31-2 2-пропанон, 1-бром-
P018 357-57-3 Брусин
P018 357-57-3 Стрихнидин-10-он, 2,3-диметокси-
P020 88-85-7 Диносеб
P020 88-85-7 Фенол, 2-(1-метилпропил)-4,6-динитро-
P021 592-01-8 Цианид кальция
P021 592-01-8 Цианид кальция Ca(CN) 2
P022 75-15-0 Сероуглерод
P023 107-20-0 Ацетальдегид, хлор-
P023 107-20-0 Хлорацетальдегид
P024 106-47-8 Бензенамин, 4-хлор-
P024 106-47-8 п-Хлоранилин
P026 5344-82-1 1-(о-Хлорфенил)тиомочевина
P026 5344-82-1 Тиомочевина (2-хлорфенил)-
P027 542-76-7 3-хлорпропионитрил
P027 542-76-7 Пропаннитрил, 3-хлор-
P028 100-44-7 Бензол, (хлорметил)-
P028 100-44-7 Бензилхлорид
P029 544-92-3 Цианид меди
P029 544-92-3 Цианид меди Cu(CN)
P030   Цианиды (растворимые соли цианидов), не указанные иначе
P031 460-19-5 Цианоген
P031 460-19-5 Этандинитрил
P033 506-77-4 Хлорциан
P033 506-77-4 Хлорид циана (CN)Cl
P034 131-89-5 2-циклогексил-4,6-динитрофенол
P034 131-89-5 Фенол, 2-циклогексил-4,6-динитро-
P036 696-28-6 Двухлористый мышьяк, фенил-
P036 696-28-6 Дихлорфениларсин
P037 60-57-1 Дильдрин
P037 60-57-1 2,7:3,6-Диметанонафт[2,3-b]оксирен, 3,4,5,6,9,9-гексахлор-1а,2,2а,3,6,6а,7,7а-октагидро -, (1аальфа,2бета,2аальфа,3бета,6бета,6аальфа,7бета, 7аальфа)-
P038 692-42-2 Арсин, диэтил-
P038 692-42-2 Диэтиларсин
P039 298-04-4 Дисульфотон
P039 298-04-4 Фосфородитиовая кислота, O,O-диэтиловый эфир S-[2-(этилтио)этил]
P040 297-97-2 О,О-диэтил-О-пиразинилфосфотиоат
P040 297-97-2 Тиофосфорная кислота, О,О-диэтиловый эфир О-пиразиниловой кислоты
P041 311-45-5 Диэтил-п-нитрофенилфосфат
P041 311-45-5 Фосфорная кислота, диэтил-4-нитрофениловый эфир
P042 51-43-4 1,2-Бензендиол, 4-[1-гидрокси-2-(метиламино)этил]-, (R)-
P042 51-43-4 Эпинефрин
P043 55-91-4 Диизопропилфторфосфат (ДФП)
P043 55-91-4 Фосфорфтористоводородная кислота, бис(1-метилэтиловый) эфир
P044 60-51-5 Диметоат
P044 60-51-5 Фосфородитиовая кислота, эфир O,O-диметил-S-[2-(метиламино)-2-оксоэтил]
P045 39196-18-4 2-Бутанон, 3,3-диметил-1-(метилтио)-, О-[(метиламино)карбонил]оксим
P045 39196-18-4 Тиофанокс
P046 122-09-8 Бензолэтанамин, альфа, альфа-диметил-
P046 122-09-8 альфа, альфа-диметилфенетиламин
P047 1 534-52-1 4,6-динитро-о-крезол и соли
P047 1 534-52-1 Фенол, 2-метил-4,6-динитро- и соли
P048 51-28-5 2,4-динитрофенол
P048 51-28-5 Фенол, 2,4-динитро-
P049 541-53-7 Дитиобиурет
P049 541-53-7 Диамид тиоимидодикарбоновой кислоты [(H 2 N)C(S)] 2 NH
P050 115-29-7 Эндосульфан
P050 115-29-7 6,9-Метано-2,4,3-бензодиоксатиепин, 6,7,8,9,10,10-гексахлор-1,5,5а,6,9,9а-гексагидро-3-оксид
P051 1 72-20-8 2,7:3,6-Диметанонафт[2,3-b]оксирен, 3,4,5,6,9,9-гексахлор-1а,2,2а,3,6,6а,7,7а-октагидро -, (1аальфа,2бета,2абета,3альфа,6альфа,6абета,7бета, 7аальфа)-, и метаболиты
P051 72-20-8 Эндрин
P051 72-20-8 Эндрин и метаболиты
P054 151-56-4 Азиридин
P054 151-56-4 Этиленимин
P056 7782-41-4 Фтор
P057 640-19-7 Ацетамид, 2-фтор-
P057 640-19-7 Фторацетамид
P058 62-74-8 Уксусная кислота, фтор-, натриевая соль
P058 62-74-8 Фторуксусная кислота, натриевая соль
P059 76-44-8 Гептахлор
P059 76-44-8 4,7-Метано-1Н-инден, 1,4,5,6,7,8,8-гептахлор-3а,4,7,7а-тетрагидро-
P060 465-73-6 1,4,5,8-Диметанонафталин, 1,2,3,4,10,10-гексахлор-1,4,4а,5,8,8а-гексагидро-, (1альфа,4альфа,4абета,5бета ,8бета,8абета)-
P060 465-73-6 Изодрин
P062 757-58-4 Гексаэтилтетрафосфат
P062 757-58-4 Тетрафосфорная кислота, гексаэтиловый эфир
P063 74-90-8 Синильная кислота
P063 74-90-8 Цианистый водород
P064 624-83-9 Метан, изоцианат-
P064 624-83-9 Метилизоцианат
P065 628-86-4 Фульминовая кислота, соль ртути(2+) (R,T)
P065 628-86-4 Гремучая ртуть (R,T)
P066 16752-77-5 Этанимидотиовая кислота, N-[[(метиламино)карбонил]окси]-, метиловый эфир
P066 16752-77-5 Метомил
P067 75-55-8 Азиридин, 2-метил-
P067 75-55-8 1,2-пропиленимин
P068 60-34-4 Гидразин, метил-
P068 60-34-4 Метилгидразин
P069 75-86-5 2-метиллактонитрил
P069 75-86-5 Пропаннитрил, 2-гидрокси-2-метил-
P070 116-06-3 Алдикарб
P070 116-06-3 Пропаналь, 2-метил-2-(метилтио)-, О-[(метиламино)карбонил]оксим
P071 298-00-0 Метилпаратион
P071 298-00-0 Тиофосфорная кислота, О,О,-диметиловый эфир О-(4-нитрофенил)
P072 86-88-4 альфа-нафтилтиомочевина
P072 86-88-4 Тиомочевина, 1-нафталенил-
P073 13463-39-3 Карбонил никеля
P073 13463-39-3 Карбонил никеля Ni(CO) 4 , (Т-4)-
P074 557-19-7 Цианид никеля
P074 557-19-7 Цианид никеля Ni(CN) 2
P075 1 54-11-5 Никотин и соли
P075 1 54-11-5 Пиридин, 3-(1-метил-2-пирролидинил)-, (S)- и соли
P076 10102-43-9 Оксид азота
P076 10102-43-9 Окись азота NO
P077 100-01-6 Бензенамин, 4-нитро-
P077 100-01-6 п-нитроанилин
P078 10102-44-0 Двуокись азота
P078 10102-44-0 Окись азота NO 2
P081 55-63-0 Нитроглицерин (R)
P081 55-63-0 1,2,3-пропантриол, тринитрат (R)
P082 62-75-9 Метанамин, -метил-N-нитрозо-
P082 62-75-9 N-нитрозодиметиламин
P084 4549-40-0 N-нитрозометилвиниламин
P084 4549-40-0 Виниламин, -метил-N-нитрозо-
P085 152-16-9 Дифосфорамид, октаметил-
P085 152-16-9 Октаметилпирофосфорамид
P087 20816-12-0 Оксид осмия OsO 4 , (Т-4)-
P087 20816-12-0 Четырехокись осмия
P088 145-73-3 Эндохолл
P088 145-73-3 7-оксабицикло[2.2.1]гептан-2,3-дикарбоновая кислота
P089 56-38-2 Паратион
P089 56-38-2 Тиофосфорная кислота, О,О-диэтиловый эфир О-(4-нитрофенил)
P092 62-38-4 Ртуть, (ацетато-О)фенил-
P092 62-38-4 Ацетат фенилртути
P093 103-85-5 Фенилтиомочевина
P093 103-85-5 Тиомочевина, фенил-
P094 298-02-2 Форат
P094 298-02-2 Фосфородитиовая кислота, O,O-диэтиловый S-[(этилтио)метиловый] эфир
P095 75-44-5 Дихлорид углерода
P095 75-44-5 Фосген
P096 7803-51-2 Фосфороводород
P096 7803-51-2 Фосфин
P097 52-85-7 Фамфур
P097 52-85-7 Тиофосфорная кислота, O-[4-[(диметиламино)сульфонил]фенил] O,O-диметиловый эфир
P098 151-50-8 Цианид калия
P098 151-50-8 Цианид калия K(CN)
P099 506-61-6 Аргентат(1-), бис(циано-C)-, калия
P099 506-61-6 Цианид калия-серебра
Р101 107-12-0 Этилцианид
Р101 107-12-0 Пропаннитрил
Р102 107-19-7 Спирт пропаргиловый
Р102 107-19-7 2-пропин-1-ол
Р103 630-10-4 Селеномочевина
Р104 506-64-9 Цианид серебра
Р104 506-64-9 Цианид серебра Ag(CN)
Р105 26628-22-8 Азид натрия
Р106 143-33-9 Цианид натрия
Р106 143-33-9 Цианид натрия Na(CN)
Р108 1 157-24-9 Стрихнидин-10-он и соли
Р108 1 157-24-9 Стрихнин и соли
Р109 3689-24-5 Тетраэтилдитиопирофосфат
Р109 3689-24-5 Тиодифосфорная кислота, тетраэтиловый эфир
Р110 78-00-2 Плюмбан тетраэтил-
Р110 78-00-2 Тетраэтилсвинец
Р111 107-49-3 Дифосфорная кислота, тетраэтиловый эфир
Р111 107-49-3 Тетраэтилпирофосфат
Р112 509-14-8 Метан тетранитро-(R)
Р112 509-14-8 Тетранитрометан (R)
Р113 1314-32-5 Оксид таллия
Р113 1314-32-5 Оксид таллия Tl 2 O 3
Р114 12039-52-0 Селениевая кислота, диталлиевая (1 + ) соль
Р114 12039-52-0 Селенит таллия(I)
Р115 7446-18-6 Серная кислота, диталлиевая (1+) соль
Р115 7446-18-6 Сульфат таллия(I)
Р116 79-19-6 Гидразинкарботиоамид
Р116 79-19-6 Тиосемикарбазид
Р118 75-70-7 Метантиол, трихлор-
Р118 75-70-7 Трихлорметантиол
Р119 7803-55-6 Ванадат аммония
Р119 7803-55-6 Ванадиевая кислота, аммониевая соль
Р120 1314-62-1 Оксид ванадия V 2 O 5
Р120 1314-62-1 Пентаоксид ванадия
Р121 557-21-1 Цианид цинка
Р121 557-21-1 Цианид цинка Zn(CN) 2
Р122 1314-84-7 Фосфид цинка Zn 3 P 2 , если присутствует в концентрациях более 10% (R, T)
Р123 8001-35-2 Токсафен
Р127 1563-66-2 7-Бензофуранол, 2,3-дигидро-2,2-диметил-, метилкарбамат.
Р127 1563-66-2 Карбофуран
Р128 315-18-4 Мексакарбат
Р128 315-18-4 Фенол, 4-(диметиламино)-3,5-диметил-, метилкарбамат (сложный эфир)
П185 26419-73-8 1,3-дитиолан-2-карбоксальдегид, 2,4-диметил-, O-[(метиламино)-карбонил]оксим.
П185 26419-73-8 Тирпате
П188 57-64-7 Бензойная кислота, 2-гидрокси-, комп.с (3aS-цис)-1,2,3,3a,8,8a-гексагидро-1,3a,8-триметилпирроло[2,3-b]индол-5-илметилкарбаматным эфиром (1:1)
П188 57-64-7 Физостигмина салицилат
Р189 55285-14-8 Карбаминовая кислота, [(дибутиламино)-тио]метил-, 2,3-дигидро-2,2-диметил-7-бензофураниловый эфир
Р189 55285-14-8 Карбосульфан
П190 1129-41-5 Карбаминовая кислота, метил-, 3-метилфениловый эфир
П190 1129-41-5 Метолкарб
П191 644-64-4 Карбаминовая кислота, диметил-, 1-[(диметиламино)карбонил]-5-метил-1Н-пиразол-3-иловый эфир
П191 644-64-4 Диметилан
Р192 119-38-0 Карбаминовая кислота, диметил-, 3-метил-1-(1-метилэтил)-1H-пиразол-5-иловый эфир
Р192 119-38-0 Изолан
П194 23135-22-0 Этанимидтиоевая кислота, 2-(диметиламино)-N-[[[(метиламино)карбонил]окси]-2-оксо-, метиловый эфир
П194 23135-22-0 Оксамил
П196 15339-36-3 Марганец, бис(диметилкарбамодитиоато-S,S’)-,
П196 15339-36-3 Диметилдитиокарбамат марганца
Р197 17702-57-7 Формпаранат
Р197 17702-57-7 Метанимидамид, N,N-диметил-N’-[2-метил-4-[ [(метиламино)карбонил]окси]фенил]-
Р198 23422-53-9 Форметаната гидрохлорид
Р198 23422-53-9 Метанимидамид, N,N-диметил-N’-[3-[ [(метиламино)-карбонил]окси]фенил]моногидрохлорид
Р199 2032-65-7 Метиокарб
Р199 2032-65-7 Фенол, (3,5-диметил-4-(метилтио)-, метилкарбамат
Р201 2631-37-0 Фенол, 3-метил-5-(1-метилэтил)-, метилкарбамат
Р201 2631-37-0 Промекарб
Р202 64-00-6 м-куменилметилкарбамат
Р202 64-00-6 3-изопропилфенил-N-метилкарбамат
Р202 64-00-6 Фенол, 3-(1-метилэтил)-, метилкарбамат
Р203 1646-88-4 Алдикарб сульфон
Р203 1646-88-4 Пропаналь, 2-метил-2-(метил-сульфонил)-, О-[(метиламино)карбонил]оксим
Р204 57-47-6 Физостигмин
Р204 57-47-6 Пирроло[2,3-b]индол-5-ол, 1,2,3,3а,8,8а-гексагидро-1,3а,8-триметил-, метилкарбамат (сложный эфир), (3aS-цис)-
Р205 137-30-4 Цинк, бис(диметилкарбамодитиоато-S,S’)-,
Р205 137-30-4 Зирам
У001 75-07-0 Ацетальдегид (I)
У001 75-07-0 Этаналь (I)
У002 67-64-1 Ацетон (I)
У002 67-64-1 2-пропанон (I)
У003 75-05-8 Ацетонитрил (И,Т)
У004 98-86-2 Ацетофенон
У004 98-86-2 Этанон, 1-фенил-
У005 53-96-3 Ацетамид, -9H-флуорен-2-ил-
У005 53-96-3 2-ацетиламинофлуорен
У006 75-36-5 Ацетилхлорид (C,R,T)
У007 79-06-1 Акриламид
У007 79-06-1 2-пропенамид
У008 79-10-7 Акриловая кислота (I)
У008 79-10-7 2-пропеновая кислота (I)
У009 107-13-1 Акрилонитрил
У009 107-13-1 2-пропенитрил
У010 50-07-7 Азирино[2′,3′:3,4]пирроло[1,2-a]индол-4,7-дион, 6-амино-8-[[[(аминокарбонил)окси]метил]-1,1a,2 ,8,8a,8b-гексагидро-8a-метокси-5-метил-, [1aS-(1aальфа, 8бета,8аальфа,8bальфа)]-
У010 50-07-7 Митомицин С
У011 61-82-5 Амитрол
У011 61-82-5 1H-1,2,4-триазол-3-амин
У012 62-53-3 Анилин (I,T)
У012 62-53-3 Бензенамин (I,T)
У014 492-80-8 Аурамин
У014 492-80-8 Бензенамин, 4,4′-карбомидоилбис[N,N-диметил-
У015 115-02-6 Азасерин
У015 115-02-6 L-серин, диазоацетат (эфир)
У016 225-51-4 Бенц[с]акридин
У017 98-87-3 Бензалхлорид
У017 98-87-3 Бензол (дихлорметил)-
У018 56-55-3 Бенз[а]антрацен
U019 71-43-2 Бензол (И,Т)
U020 98-09-9 Хлорангидрид бензолсульфокислоты (C,R)
U020 98-09-9 Бензолсульфонилхлорид (C,R)
U021 92-87-5 Бензидин
U021 92-87-5 [1,1′-бифенил]-4,4′-диамин
U022 50-32-8 Бенз[а]пирен
U023 98-07-7 Бензол (трихлорметил)-
U023 98-07-7 Бензотрихлорид (C,R,T)
U024 111-91-1 Дихлорметоксиэтан
U024 111-91-1 Этан, 1,1′-[метиленбис(окси)]бис[2-хлор-
U025 111-44-4 Дихлорэтиловый эфир
U025 111-44-4 Этан, 1,1′-оксибис[2-хлор-
U026 494-03-1 Хлорнафазин
U026 494-03-1 Нафталинамин, N,N’-бис(2-хлорэтил)-
U027 108-60-1 Дихлоризопропиловый эфир
U027 108-60-1 Пропан, 2,2′-оксибис[2-хлор-
U028 117-81-7 1,2-Бензолдикарбоновая кислота, бис(2-этилгексил) сложный эфир
U028 117-81-7 Диэтилгексилфталат
U029 74-83-9 Метан, бром-
U029 74-83-9 Метилбромид
U030 101-55-3 Бензол, 1-бром-4-фенокси-
U030 101-55-3 4-бромфенилфениловый эфир
U031 71-36-3 1-бутанол (I)
U031 71-36-3 н-Бутиловый спирт (I)
U032 13765-19-0 Хромат кальция
U032 13765-19-0 Хромовая кислота H 2 CrO 4 , соль кальция
U033 353-50-4 Дифторид углерода
U033 353-50-4 Фторид углерода (R,T)
У034 75-87-6 Ацетальдегид трихлор-
У034 75-87-6 Хлораль
U035 305-03-3 Бензолбутановая кислота, 4-[бис(2-хлорэтил)амино]-
U035 305-03-3 Хлорамбуцил
У036 57-74-9 Хлордан, альфа- и гамма-изомеры
У036 57-74-9 4,7-Метано-1Н-инден, 1,2,4,5,6,7,8,8-октахлор-2,3,3а,4,7,7а-гексагидро-
U037 108-90-7 Бензол, хлор-
U037 108-90-7 Хлорбензол
У038 510-15-6 Бензолуксусная кислота, 4-хлор-альфа-(4-хлорфенил)-альфа-гидрокси-, этиловый эфир
У038 510-15-6 Хлорбензилат
U039 59-50-7 п-хлор-м-крезол
U039 59-50-7 Фенол, 4-хлор-3-метил-
У041 106-89-8 Эпихлоргидрин
У041 106-89-8 Оксиран, (хлорметил)-
У042 110-75-8 2-хлорэтилвиниловый эфир
У042 110-75-8 Этен, (2-хлорэтокси)-
У043 75-01-4 Этен, хлор-
У043 75-01-4 Винилхлорид
У044 67-66-3 Хлороформ
У044 67-66-3 Метан, трихлор-
У045 74-87-3 Метан, хлор- (I,T)
У045 74-87-3 Метилхлорид (I,T)
У046 107-30-2 Хлорметилметиловый эфир
У046 107-30-2 Метан, хлорметокси-
У047 91-58-7 бета-хлоронафталин
У047 91-58-7 Нафталин, 2-хлор-
У048 95-57-8 о-Хлорфенол
У048 95-57-8 Фенол, 2-хлор-
У049 3165-93-3 Бензенамин, 4-хлор-2-метил-, гидрохлорид
У049 3165-93-3 4-Хлор-о-толуидин, гидрохлорид
U050 218-01-9 Хризен
U051   Креозот
У052 1319-77-3 Крезол (крезиловая кислота)
У052 1319-77-3 Фенол, метил-
У053 4170-30-3 2-бутеналь
У053 4170-30-3 Кротоновый альдегид
У055 98-82-8 Бензол, (1-метилэтил)-(I)
У055 98-82-8 Кумол (I)
У056 110-82-7 Бензол гексагидро-(I)
У056 110-82-7 Циклогексан (I)
U057 108-94-1 Циклогексанон (I)
У058 50-18-0 Циклофосфамид
У058 50-18-0 2H-1,3,2-оксазафосфорин-2-амин, N,N-бис(2-хлорэтил)тетрагидро-, 2-оксид
U059 20830-81-3 Дауномицин
U059 20830-81-3 5,12-Нафтацендион, 8-ацетил-10-[(3-амино-2,3,6-тридеокси)-альфа-L-ликсо-гексопиранозил)окси]-7,8,9,10-тетрагидро-6 ,8,11-тригидрокси-1-метокси-, (8S-цис)-
У060 72-54-8 Бензол, 1,1′-(2,2-дихлорэтилиден)бис[4-хлор-
У060 72-54-8 ДДД
У061 50-29-3 Бензол, 1,1′-(2,2,2-трихлорэтилиден)бис[4-хлор-
У061 50-29-3 ДДТ
У062 2303-16-4 Карбамотиевая кислота, бис(1-метилэтил)-, S-(2,3-дихлор-2-пропенил) сложный эфир
У062 2303-16-4 Набрать номер
У063 53-70-3 Дибенз[а,ч]антрацен
У064 189-55-9 Бенз[рст]пентафен
У064 189-55-9 Дибензо[а,и]пирен
У066 96-12-8 1,2-дибром-3-хлорпропан
У066 96-12-8 Пропан, 1,2-дибром-3-хлор-
У067 106-93-4 Этан, 1,2-дибром-
У067 106-93-4 Этилендибромид
У068 74-95-3 Метан, дибром-
У068 74-95-3 Бромид метилена
У069 84-74-2 1,2-Бензолдикарбоновая кислота, дибутиловый эфир
У069 84-74-2 Дибутилфталат
У070 95-50-1 Бензол, 1,2-дихлор-
У070 95-50-1 о-Дихлорбензол
У071 541-73-1 Бензол, 1,3-дихлор-
У071 541-73-1 м-Дихлорбензол
У072 106-46-7 Бензол, 1,4-дихлор-
У072 106-46-7 п-Дихлорбензол
У073 91-94-1 [1,1′-Бифенил]-4,4′-диамин, 3,3′-дихлор-
У073 91-94-1 3,3′-Дихлорбензидин
У074 764-41-0 2-бутен, 1,4-дихлор-(I,T)
У074 764-41-0 1,4-дихлор-2-бутен (I,T)
У075 75-71-8 Дихлордифторметан
У075 75-71-8 Метан, дихлордифтор-
У076 75-34-3 Этан, 1,1-дихлор-
У076 75-34-3 Этилидендихлорид
У077 107-06-2 Этан, 1,2-дихлор-
У077 107-06-2 Этилендихлорид
У078 ​​ 75-35-4 1,1-Дихлорэтилен
У078 ​​ 75-35-4 Этен, 1,1-дихлор-
У079 156-60-5 1,2-дихлорэтилен
У079 156-60-5 Этен, 1,2-дихлор-, (E)-
У080 75-09-2 Метан, дихлор-
У080 75-09-2 Метиленхлорид
У081 120-83-2 2,4-дихлорфенол
У081 120-83-2 Фенол, 2,4-дихлор-
У082 87-65-0 2,6-Дихлорфенол
У082 87-65-0 Фенол, 2,6-дихлор-
У083 78-87-5 Пропан, 1,2-дихлор-
У083 78-87-5 Дихлорид пропилена
У084 542-75-6 1,3-дихлорпропен
У084 542-75-6 1-Пропен, 1,3-дихлор-
У085 1464-53-5 2,2′-Биоксиран
У085 1464-53-5 1,2:3,4-диэпоксибутан (I,T)
У086 1615-80-1 N,N’-диэтилгидразин
У086 1615-80-1 Гидразин, 1,2-диэтил-
У087 3288-58-2 О,О-диэтил S-метилдитиофосфат
У087 3288-58-2 Фосфородитиовая кислота, O,O-диэтиловый S-метиловый эфир
У088 84-66-2 1,2-Бензолдикарбоновая кислота, диэтиловый эфир
У088 84-66-2 Диэтилфталат
У089 56-53-1 Диэтилстильстерол
У089 56-53-1 Фенол, 4,4′-(1,2-диэтил-1,2-этендиил)бис-, (Е)-
У090 94-58-6 1,3-Бензодиоксол, 5-пропил-
У090 94-58-6 Дигидросафрол
У091 119-90-4 [1,1′-Бифенил]-4,4′-диамин, 3,3′-диметокси-
У091 119-90-4 3,3′-Диметоксибензидин
У092 124-40-3 Диметиламин (I)
У092 124-40-3 Метанамин, -метил-(I)
У093 60-11-7 Бензенамин, N,N-диметил-4-(фенилазо)-
У093 60-11-7 п-диметиламиноазобензол
У094 57-97-6 Бенз[а]антрацен, 7,12-диметил-
У094 57-97-6 7,12-Диметилбенз[а]антрацен
У095 119-93-7 [1,1′-Бифенил]-4,4′-диамин, 3,3′-диметил-
У095 119-93-7 3,3′-диметилбензидин
У096 80-15-9 альфа, альфа-диметилбензилгидропероксид (R)
У096 80-15-9 Гидропероксид, 1-метил-1-фенилэтил-(R)
У097 79-44-7 Карбаминхлорид диметил-
У097 79-44-7 Диметилкарбамоилхлорид
У098 57-14-7 1,1-диметилгидразин
У098 57-14-7 Гидразин, 1,1-диметил-
У099 540-73-8 1,2-диметилгидразин
У099 540-73-8 Гидразин, 1,2-диметил-
У101 105-67-9 2,4-диметилфенол
У101 105-67-9 Фенол, 2,4-диметил-
U102 131-11-3 1,2-Бензолдикарбоновая кислота, диметиловый эфир
U102 131-11-3 Диметилфталат
У103 77-78-1 Диметилсульфат
У103 77-78-1 Серная кислота, диметиловый эфир
У105 121-14-2 Бензол, 1-метил-2,4-динитро-
У105 121-14-2 2,4-динитротолуол
У106 606-20-2 Бензол, 2-метил-1,3-динитро-
У106 606-20-2 2,6-динитротолуол
У107 117-84-0 1,2-Бензолдикарбоновая кислота, диоктиловый эфир
У107 117-84-0 Ди-н-октилфталат
У108 123-91-1 1,4-диэтиленоксид
У108 123-91-1 1,4-диоксан
У109 122-66-7 1,2-дифенилгидразин
У109 122-66-7 Гидразин, 1,2-дифенил-
U110 142-84-7 Дипропиламин (I)
U110 142-84-7 1-Пропанамин, N-пропил-(I)
У111 621-64-7 Ди-н-пропилнитрозамин
У111 621-64-7 1-Пропанамин, N-нитрозо-N-пропил-
U112 141-78-6 Этиловый эфир уксусной кислоты (I)
U112 141-78-6 Этилацетат (I)
У113 140-88-5 Этилакрилат (I)
У113 140-88-5 2-пропеновая кислота, этиловый эфир (I)
У114 1 111-54-6 Карбамодитиовая кислота, 1,2-этандиилбис-, соли и сложные эфиры
У114 1 111-54-6 Этиленбисдитиокарбаминовая кислота, соли и сложные эфиры
U115 75-21-8 Этиленоксид (I,T)
U115 75-21-8 Оксиран (I,T)
U116 96-45-7 Этилентиомочевина
U116 96-45-7 2-имидазолидинтион
U117 60-29-7 Этан, 1,1′-оксибис-(I)
U117 60-29-7 Этиловый эфир (I)
U118 97-63-2 Этилметакрилат
U118 97-63-2 2-пропеновая кислота, 2-метил-, этиловый эфир
U119 62-50-0 Этилметансульфонат
U119 62-50-0 Метансульфокислота, этиловый эфир
U120 206-44-0 Флуорантен
U121 75-69-4 Метан, трихлорфтор-
U121 75-69-4 Трихлормонофторметан
U122 50-00-0 Формальдегид
U123 64-18-6 Муравьиная кислота (C,T)
U124 110-00-9 Фуран (I)
U124 110-00-9 Фурфуран (I)
U125 98-01-1 2-фуранкарбоксальдегид (I)
U125 98-01-1 Фурфурол (I)
U126 765-34-4 Глицидиловый альдегид
U126 765-34-4 Оксиранкарбоксиальдегид
U127 118-74-1 Бензол, гексахлор-
U127 118-74-1 Гексахлорбензол
U128 87-68-3 1,3-бутадиен, 1,1,2,3,4,4-гексахлор-
U128 87-68-3 Гексахлорбутадиен
U129 58-89-9 Циклогексан, 1,2,3,4,5,6-гексахлор-, (1альфа,2альфа,3бета,4альфа,5альфа,6бета)-
U129 58-89-9 Линдан
U130 77-47-4 1,3-Циклопентадиен, 1,2,3,4,5,5-гексахлор-
U130 77-47-4 Гексахлорциклопентадиен
У131 67-72-1 Этан, гексахлор-
У131 67-72-1 Гексахлорэтан
U132 70-30-4 Гексахлорофен
U132 70-30-4 Фенол, 2,2′-метиленбис[3,4,6-трихлор-
У133 302-01-2 Гидразин (R,T)
U134 7664-39-3 Плавиковая кислота (C,T)
U134 7664-39-3 Фторид водорода (C,T)
U135 7783-06-4 Сероводород
U135 7783-06-4 Сероводород H 2 S
U136 75-60-5 Арсиновая кислота, диметил-
U136 75-60-5 Какодиловая кислота
U137 193-39-5 Индено[1,2,3-cd]пирен
U138 74-88-4 Метан, йод-
U138 74-88-4 Метилиодид
U140 78-83-1 Спирт изобутиловый (I,T)
U140 78-83-1 1-пропанол, 2-метил-(I,T)
У141 120-58-1 1,3-Бензодиоксол, 5-(1-пропенил)-
У141 120-58-1 Изосафрол
У142 143-50-0 Кепоне
У142 143-50-0 1,3,4-Метено-2Н-циклобута[cd]пентален-2-он, 1,1а,3,3а,4,5,5,5а,5b,6-декахлороктагидро-
У143 303-34-4 2-Бутеновая кислота, 2-метил-, 7-[[2,3-дигидрокси-2-(1-метоксиэтил)-3-метил-1-оксобутокси]метил]-2,3,5,7а-тетрагидро- 1H-пирролизин-1-иловый эфир, [1S-[1альфа(Z),7(2S*,3R*),7альфа]]-
У143 303-34-4 Лазиокарпин
У144 301-04-2 Уксусная кислота, соль свинца(2+)
У144 301-04-2 Ацетат свинца
U145 7446-27-7 Фосфат свинца
U145 7446-27-7 Фосфорная кислота, соль свинца(2+) (2:3)
У146 1335-32-6 Свинец, бис(ацетато-О)тетрагидрокситри-
У146 1335-32-6 Субацетат свинца
У147 108-31-6 2,5-фурандион
У147 108-31-6 Малеиновый ангидрид
У148 123-33-1 Малеиновый гидразид
У148 123-33-1 3,6-пиридазиндион, 1,2-дигидро-
У149 109-77-3 Малононитрил
У149 109-77-3 Пропандинитрил
U150 148-82-3 Мелфалан
U150 148-82-3 L-фенилаланин, 4-[бис(2-хлорэтил)амино]-
У151 7439-97-6 Меркурий
U152 126-98-7 Метакрилонитрил (I,T)
U152 126-98-7 2-Пропенитрил, 2-метил-(I,T)
У153 74-93-1 Метантиол (I,T)
У153 74-93-1 Тиометанол (I,T)
У154 67-56-1 Метанол (I)
У154 67-56-1 Спирт метиловый (I)
U155 91-80-5 1,2-Этандиамин, N,N-диметил-N’-2-пиридинил-N’-(2-тиенилметил)-
U155 91-80-5 Метапирилен
U156 79-22-1 Кислота хлоругольная, метиловый эфир (I,T)
U156 79-22-1 Метилхлоркарбонат (I,T)
U157 56-49-5 Бенз[j]ацеантрилен, 1,2-дигидро-3-метил-
U157 56-49-5 3-метилхолантрен
U158 101-14-4 Бензенамин, 4,4′-метиленбис[2-хлор-
U158 101-14-4 4,4′-метиленбис(2-хлоранилин)
U159 78-93-3 2-бутанон (I,T)
U159 78-93-3 Метилэтилкетон (МЭК) (I,T)
U160 1338-23-4 2-бутанон, пероксид (R,T)
U160 1338-23-4 Перекись метилэтилкетона (R,T)
U161 108-10-1 Метилизобутилкетон (I)
U161 108-10-1 4-Метил-2-пентанон (I)
U161 108-10-1 Пентанол, 4-метил-
U162 80-62-6 Метилметакрилат (I,T)
U162 80-62-6 2-пропеновая кислота, 2-метил-, метиловый эфир (I,T)
U163 70-25-7 Гуанидин, -метил-N’-нитро-N-нитрозо-
U163 70-25-7 МННГ
U164 56-04-2 Метилтиоурацил
U164 56-04-2 4(1H)-пиримидинон, 2,3-дигидро-6-метил-2-тиоксо-
U165 91-20-3 Нафталин
U166 130-15-4 1,4-Нафталендион
U166 130-15-4 1,4-Нафтохинон
U167 134-32-7 1-Нафталинамин
U167 134-32-7 альфа-нафтиламин
U168 91-59-8 2-Нафталинамин
U168 91-59-8 бета-нафтиламин
U169 98-95-3 Бензол, нитро-
U169 98-95-3 Нитробензол (I,T)
U170 100-02-7 п-нитрофенол
U170 100-02-7 Фенол, 4-нитро-
У171 79-46-9 2-нитропропан (I,T)
У171 79-46-9 Пропан, 2-нитро-(I,T)
U172 924-16-3 1-Бутанамин, N-бутил-N-нитрозо-
U172 924-16-3 N-нитрозоди-н-бутиламин
U173 1116-54-7 Этанол, 2,2′-(нитрозоимино)бис-
U173 1116-54-7 N-нитрозодиэтаноламин
U174 55-18-5 Этанамин, -этил-N-нитрозо-
U174 55-18-5 N-Nitrosodiethylamine
U176 759-73-9 N-Nitroso-N-ethylurea
U176 759-73-9 Urea, N-ethyl-N-nitroso-
U177 684-93-5 N-Nitroso-N-methylurea
U177 684-93-5 Urea, N-methyl-N-nitroso-
U178 615-53-2 Carbamic acid, methylnitroso-, ethyl ester
U178 615-53-2 N-Nitroso-N-methylurethane
U179 100-75-4 N-Nitrosopiperidine
U179 100-75-4 Piperidine, 1-nitroso-
U180 930-55-2 N-Nitrosopyrrolidine
U180 930-55-2 Pyrrolidine, 1-nitroso-
U181 99-55-8 Benzenamine, 2-methyl-5-nitro-
U181 99-55-8 5-Nitro-o-toluidine
U182 123-63-7 1,3,5-Trioxane, 2,4,6-trimethyl-
U182 123-63-7 Paraldehyde
U183 608-93-5 Benzene, pentachloro-
U183 608-93-5 Pentachlorobenzene
U184 76-01-7 Ethane, pentachloro-
U184 76-01-7 Pentachloroethane
U185 82-68-8 Benzene, pentachloronitro-
U185 82-68-8 Pentachloronitrobenzene (PCNB)
U186 504-60-9 1-Methylbutadiene (I)
U186 504-60-9 1,3-Pentadiene (I)
U187 62-44-2 Acetamide, -(4-ethoxyphenyl)-
U187 62-44-2 Phenacetin
U188 108-95-2 Phenol
U189 1314-80-3 Phosphorus sulfide (R)
U189 1314-80-3 Sulfur phosphide (R)
U190 85-44-9 1,3-Isobenzofurandione
U190 85-44-9 Phthalic anhydride
U191 109-06-8 2-Picoline
U191 109-06-8 Pyridine, 2-methyl-
U192 23950-58-5 Benzamide, 3,5-dichloro-N-(1,1-dimethyl-2-propynyl)-
U192 23950-58-5 Pronamide
U193 1120-71-4 1,2-Oxathiolane, 2,2-dioxide
U193 1120-71-4 1,3-Propane sultone
U194 107-10-8 1-Propanamine (I,T)
U194 107-10-8 n-Propylamine (I,T)
U196 110-86-1 Pyridine
U197 106-51-4 p-Benzoquinone
U197 106-51-4 2,5-Cyclohexadiene-1,4-dione
U200 50-55-5 Reserpine
U200 50-55-5 Yohimban-16-carboxylic acid, 11,17-dimethoxy-18-[(3,4,5-trimethoxybenzoyl)oxy]-, methyl ester,(3beta,16beta,17alpha,18beta,20alpha)-
U201 108-46-3 1,3-Benzenediol
U201 108-46-3 Resorcinol
U203 94-59-7 1,3-Benzodioxole, 5-(2-propenyl)-
U203 94-59-7 Safrole
U204 7783-00-8 Selenious acid
U204 7783-00-8 Selenium dioxide
U205 7488-56-4 Selenium sulfide
U205 7488-56-4 Selenium sulfide SeS 2 (R,T)
U206 18883-66-4 Glucopyranose, 2-deoxy-2-(3-methyl-3-nitrosoureido)-, D-
U206 18883-66-4 D-Glucose, 2-deoxy-2-[ [(methylnitrosoamino)-carbonyl]amino]-
U206 18883-66-4 Streptozotocin
U207 95-94-3 Benzene, 1,2,4,5-tetrachloro-
U207 95-94-3 1,2,4,5-Tetrachlorobenzene
U208 630-20-6 Ethane, 1,1,1,2-tetrachloro-
U208 630-20-6 1,1,1,2-Tetrachloroethane
U209 79-34-5 Ethane, 1,1,2,2-tetrachloro-
U209 79-34-5 1,1,2,2-Tetrachloroethane
U210 127-18-4 Ethene, tetrachloro-
U210 127-18-4 Tetrachloroethylene
U211 56-23-5 Carbon tetrachloride
U211 56-23-5 Methane, tetrachloro-
U213 109-99-9 Furan, tetrahydro-(I)
U213 109-99-9 Tetrahydrofuran (I)
U214 563-68-8 Acetic acid, thallium(1 + ) salt
U214 563-68-8 Thallium(I) acetate
U215 6533-73-9 Carbonic acid, dithallium(1 + ) salt
U215 6533-73-9 Thallium(I) carbonate
U216 7791-12-0 Thallium(I) chloride
U216 7791-12-0 Thallium chloride TlCl
U217 10102-45-1 Nitric acid, thallium(1 + ) salt
U217 10102-45-1 Thallium(I) nitrate
U218 62-55-5 Ethanethioamide
U218 62-55-5 Thioacetamide
U219 62-56-6 Thiourea
U220 108-88-3 Benzene, methyl-
U220 108-88-3 Toluene
U221 25376-45-8 Benzenediamine, ar-methyl-
U221 25376-45-8 Toluenediamine
U222 636-21-5 Benzenamine, 2-methyl-, hydrochloride
U222 636-21-5 o-Toluidine hydrochloride
U223 26471-62-5 Benzene, 1,3-diisocyanatomethyl- (R,T)
U223 26471-62-5 Toluene diisocyanate (R,T)
U225 75-25-2 Bromoform
U225 75-25-2 Methane, tribromo-
U226 71-55-6 Ethane, 1,1,1-trichloro-
U226 71-55-6 Methyl chloroform
U226 71-55-6 1,1,1-Trichloroethane
U227 79-00-5 Ethane, 1,1,2-trichloro-
U227 79-00-5 1,1,2-Trichloroethane
U228 79-01-6 Ethene, trichloro-
U228 79-01-6 Trichloroethylene
U234 99-35-4 Benzene, 1,3,5-trinitro-
U234 99-35-4 1,3,5-Trinitrobenzene (R,T)
U235 126-72-7 1-Propanol, 2,3-dibromo-, phosphate (3:1)
U235 126-72-7 Tris(2,3-dibromopropyl) phosphate
U236 72-57-1 2,7-Naphthalenedisulfonic acid, 3,3′-[(3,3′-dimethyl[1,1′-biphenyl]-4,4′-diyl)bis(azo)bis[5-amino-4-hydroxy]-, tetrasodium salt
U236 72-57-1 Trypan blue
U237 66-75-1 2,4-(1H,3H)-Pyrimidinedione, 5-[bis(2-chloroethyl)amino]-
U237 66-75-1 Uracil mustard
U238 51-79-6 Carbamic acid, ethyl ester
U238 51-79-6 Ethyl carbamate (urethane)
U239 1330-20-7 Benzene, dimethyl- (I,T)
U239 1330-20-7 Xylene (I)
U240 194-75-7 Acetic acid, (2,4-dichlorophenoxy)-, salts & esters
U240 194-75-7 2,4-D, salts & esters
U243 1888-71-7 Hexachloropropene
U243 1888-71-7 1-Propene, 1,1,2,3,3,3-hexachloro-
U244 137-26-8 Thioperoxydicarbonic diamide [(H 2 N)C(S)] 2 S 2 , tetramethyl-
U244 137-26-8 Thiram
U246 506-68-3 Cyanogen bromide (CN)Br
U247 72-43-5 Benzene, 1,1′-(2,2,2-trichloroethylidene)bis[4- methoxy-
U247 72-43-5 Methoxychlor
U248 181-81-2 2H-1-Benzopyran-2-one, 4-hydroxy-3-(3-oxo-1-phenyl-butyl)-, & salts, when present at concentrations of 0.3% или меньше
У248 181-81-2 Варфарин и его соли, если они присутствуют в концентрации 0,3% или менее
У249 1314-84-7 Фосфид цинка Zn 3 P 2 , если присутствует в концентрации 10% или менее
У271 17804-35-2 Беномил
У271 17804-35-2 Карбаминовая кислота, [1-[(бутиламино)карбонил]-1H-бензимидазол-2-ил]-, метиловый эфир
У278 22781-23-3 Бендиокарб
У278 22781-23-3 1,3-Бензодиоксол-4-ол, 2,2-диметил-, метилкарбамат
У279 63-25-2 Карбарил
У279 63-25-2 1-Нафталенол, метилкарбамат
U280 101-27-9 Барбан
U280 101-27-9 Карбаминовая кислота, (3-хлорфенил)-, 4-хлор-2-бутиниловый эфир
У328 95-53-4 Бензенамин, 2-метил-
У328 95-53-4 о-толуидин
У353 106-49-0 Бензенамин, 4-метил-
У353 106-49-0 п-толуидин
У359 110-80-5 Этанол, 2-этокси-
У359 110-80-5 Моноэтиловый эфир этиленгликоля
U364 22961-82-6 Бендиокарб фенол
U364 22961-82-6 1,3-Бензодиоксол-4-ол, 2,2-диметил-,
U367 1563-38-8 7-Бензофуранол, 2,3-дигидро-2,2-диметил-
U367 1563-38-8 Карбофуран фенол
У372 10605-21-7 Карбаминовая кислота, 1H-бензимидазол-2-ил, метиловый эфир
У372 10605-21-7 Карбендазим
У373 122-42-9 Карбаминовая кислота, фенил-, 1-метилэтиловый эфир
У373 122-42-9 Профам
У387 52888-80-9 Карбамотиевая кислота, дипропиловый, S-(фенилметиловый) эфир
У387 52888-80-9 Просульфокарб
У389 2303-17-5 Карбамотиевая кислота, бис(1-метилэтил)-, S-(2,3,3-трихлор-2-пропенил) сложный эфир
У389 2303-17-5 Триаллат
У394 30558-43-1 А2213
У394 30558-43-1 Этанимидотиовая кислота, 2-(диметиламино)-N-гидрокси-2-оксо-, метиловый эфир
У395 5952-26-1 Диэтиленгликоль, дикарбамат
У395 5952-26-1 Этанол, 2,2′-оксибис-, дикарбамат
У404 121-44-8 Этанамин, N,N-диэтил-
У404 121-44-8 Триэтиламин
У409 23564-05-8 Карбаминовая кислота, [1,2-фениленбис(иминокарбонотиоил)]бис-диметиловый эфир
У409 23564-05-8 Тиофанат-метил
U410 59669-26-0 Этанимидотиовая кислота, N,N’-[тиобис[(метилимино)карбонилокси]]бис-диметиловый эфир
U410 59669-26-0 Тиодикарб
У411 114-26-1 Фенол, 2-(1-метилэтокси)-, метилкарбамат
У411 114-26-1 Пропоксур
См. F027 93-76-5 Уксусная кислота (2,4,5-трихлорфенокси)-
См. F027 87-86-5 Пентахлорфенол
См. F027 87-86-5 Фенол, пентахлор-
См. F027 58-90-2 Фенол, 2,3,4,6-тетрахлор-
См. F027 95-95-4 Фенол, 2,4,5-трихлор-
См. F027 88-06-2 Фенол, 2,4,6-трихлор-
См. F027 93-72-1 Пропановая кислота, 2-(2,4,5-трихлорфенокси)-
См. F027 93-72-1 Сильвекс (2,4,5-ТП)
См. F027 93-76-5 2,4,5-Т
См. F027 58-90-2 2,3,4,6-тетрахлорфенол
См. F027 95-95-4 2,4,5-трихлорфенол
См. F027 88-06-2 2,4,6-трихлорфенол

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка браузера на прием файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

Автомобили советского блока были странными: ГАЗ 69

Что это?

Автомобиль ГАЗ-69 является заменой ГАЗ-67Б. Он отличается меньшим расходом топлива и улучшенными внедорожными качествами.Разработка автомобиля началась в 1946 году, а год спустя был готов первый действующий прототип.

Где и когда он был изготовлен?

Производство автомобиля ГАЗ 69 началось 25 августа 1953 года на ГАЗе в городе Горьком. К концу 1972 г. было построено более 600 000 единиц, большинство из них на УАЗе, производство которого было передано в 1956 г.

Технические данные:

-цилиндровый бензиновый безнаддувный двигатель, передающий мощность на все четыре колеса через трехступенчатую механическую коробку передач.Интересно, что у автомобиля два топливных бака — один под полом и один под сиденьем пассажира.

Стандартный ГАЗ 69 имеет мощность 55 лошадиных сил (41 киловатт) и максимальную скорость 56 миль в час (90 километров в час), тогда как более мощный ГАЗ 69М имеет мощность 65 л.с. (48 кВт) и максимальную скорость 62 мили в час ( 100 км/ч).

Что в нем особенного?

Ну, это был в основном армейский автомобиль, также доступный для гражданских клиентов. Это сверхспособная внедорожная машина с прочным шасси и хорошими углами поворота.Он использует 2,1-литровый двигатель от седана ГАЗ М20 «Победа» — мотор, основанный на классическом двигателе Dodge 1935 года, чертежи которого были приобретены за 20 000 долларов.

Неразрушимый. Я имею в виду — серьезно. Спустя более 50 лет после выпуска ГАЗ 69 до сих пор используется в некоторых странах Восточной Европы для повседневной езды по пересеченной местности. Поздние экземпляры очень популярны среди коллекционеров автомобилей, а цены на невосстановленные экземпляры начинаются примерно от 10 000 долларов.

Автомобиль послужил базой для множества различных проектов в Советской России.Его преемник, УАЗ-469 (также представленный в нашей серии «Автомобили советского блока были странными»), ведет свое происхождение от конструкции 69, в то время как некоторые довольно впечатляющие машины, такие как истребитель танков 2П26 и автомобиль-амфибия ГАЗ 46 МАВ 4×4 также были основаны на 69.

Несколько экземпляров ГАЗ 69 в настоящее время находятся на заслуженном отдыхе в различных музеях мира, включая Музей транспорта в западной части округа Сент-Луис, штат Миссури, США, и Форт аан ден Хук ван Холланд в Нидерландах.


Фотографии: Auto WP

Характеристики сгорания и оптимизация ЦПГ (сжатого генераторного газа) в постоянном объеме 1 90

Автор

Abstract

PG (генераторный газ) из газификации биомассы может использоваться либо в SI (искровом воспламенении), либо в CI (компрессионном воспламенении) двигателе. В настоящем исследовании с использованием оптического метода оцениваются основные характеристики горения SI CPG (сжатый генераторный газ) в CVCC (камера сгорания постоянного объема) при различных коэффициентах эквивалентности (ϕ).Характеристики горения сравнивались с обычными видами топлива: бензином, КПГ (сжатым природным газом) и СУГ (сжиженным нефтяным газом). Количество воздуха, необходимое для каждого ϕ, рассчитывалось исходя из фиксированной массы впрыскиваемого бензина. Для исследования оптимизации CPG был протестирован при различных MIF (коэффициентах увеличения массы): MIF = 0% (минимальная конфигурация), MIF = 25% (средняя конфигурация) и MIF = 50% (максимальная конфигурация) с использованием DOE (схема эксперимента). . Был проведен ANOVA (дисперсионный анализ), и значения экспериментальной надежности были равны 0.9775 и 0,9875% для скорости пламени и пикового давления соответственно. Из экспериментов было установлено, что скорость пламени и пиковое давление ЦПГ составляют 3,15 м/с и 312,09 кПа соответственно. Они были ниже по сравнению с бензином, СНГ и КПГ. Оптимизационный анализ показывает, что пиковое давление ЦПГ сравнимо с бензином и достигает максимальной скорости пламени при ϕ = 1,1 и MIF = 35%.

Рекомендуемое цитирование

  • Сойд, С.Н. и Зайнал, З.А., 2014. » Характеристики сгорания и оптимизация CPG (сжатого генераторного газа) в камере сгорания постоянного объема ,» Энергия, Эльзевир, том.73(С), страницы 59-69.
  • Обработчик: RePEc:eee:energy:v:73:y:2014:i:c:p:59-69
    DOI: 10.1016/j.energy.2014.05.066

    Скачать полный текст от издателя

    Поскольку доступ к этому документу ограничен, вы можете поискать другую его версию.

    Каталожные номера указаны в IDEAS

    1. Сойд С.Н. и Зайнал З.А., 2011. « Характеристика распыления и сгорания для двигателей внутреннего сгорания с использованием оптических методов измерения — Обзор ,» Энергия, Эльзевир, том.36(2), страницы 724-741.
    2. Мерола, Симона С. и Семента, Паоло и Торнаторе, Чинция и Вальеко, Бьянка М., 2010 г. » Влияние стратегии впрыска топлива на процесс сгорания в двигателе с искровым зажиганием с наддувом PFI ,» Энергия, Эльзевир, том. 35(2), страницы 1094-1100.
    3. Мерола, Симона С. и Вальеко, Бьянка М., 2009 г. « Оптические исследования горения отложений топлива в двигателях с искровым зажиганием (SI) с распределенным впрыском топлива (PFI) ,» Энергия, Эльзевир, том.34(12), страницы 2108-2115.
    Полные ссылки (включая те, которые не соответствуют элементам в IDEAS)

    Наиболее похожие товары

    Это элементы, которые чаще всего цитируют те же работы, что и этот, и цитируются теми же работами, что и этот.
    1. Пастор, Дж. В., Бермудес, В., Гарсия-Оливер, Дж. М., и Рамирес-Эрнандес, Дж. Г., 2011 г. » Влияние конфигурации распылительной свечи накаливания на сгорание при холодном пуске высокоскоростных дизельных двигателей с непосредственным впрыском ,» Энергия, Эльзевир, том.36(9), страницы 5486-5496.
    2. Коста М. и Маркитто Л. и Мерола С. С. и Зорге У., 2014 г. « Изучение смесеобразования и раннего развития пламени в исследовательском двигателе GDI (бензиновый непосредственный впрыск) с помощью численного моделирования и УФ-цифровой визуализации ,» Энергия, Эльзевир, том. 77(С), страницы 88-96.
    3. Сойд С.Н. и Зайнал З.А., 2011. « Характеристика распыления и сгорания для двигателей внутреннего сгорания с использованием оптических методов измерения — Обзор ,» Энергия, Эльзевир, том.36(2), страницы 724-741.
    4. Хайфэн Лю, Бейлин Чен, Лэй Фэн, Юй Ван, Вентао И и Мингфа Яо, 2018 г. « Исследование распределения топлива в распыляемой на стену дизельной струе при различных температурах стенки с помощью эксиплексной флуоресценции, индуцированной лазером (LIEF) ,» Энергии, МДПИ, вып. 11(5), страницы 1-14, май.
    5. Камалтдинов В.Г., Марков В.А., Лысов И.О., Жердев А.А., Фурман В.В., 2019. « Экспериментальные исследования впрыска топлива в дизельном двигателе с наклонной форсункой «, Энергии, МДПИ, вып.12(14), страницы 1-18, июль.
    6. Хуан, Вейди и Ву, Чжицзюнь и Гао, Я и Чжан, Линь, 2015 г. « Влияние ударных волн на эволюцию топливных струй высокого давления ,» Прикладная энергия, Elsevier, vol. 159(С), страницы 442-448.
    7. Чжан, Чжицзинь и Чжан, Хайянь и Ван, Тянью и Цзя, Мин, 2014 г. « Влияние переворачивания в сочетании с рециркуляцией отработавших газов (EGR) на сгорание и выбросы в двигателе с искровым зажиганием при частичных нагрузках ,» Энергия, Эльзевир, том.65(С), страницы 18-24.
    8. Пак, Чолун и Ким, Сундэ и Ким, Хонсук и Мориёси, Ясуо, 2012 г. » Характеристики стратифицированного обедненного сгорания в системе сгорания с распылением в бензиновом двигателе с непосредственным впрыском ,» Энергия, Эльзевир, том. 41(1), страницы 401-407.
    9. Юаньчжи Тан, Димин Лу, Чэнгуан Ван, Пи-цян Тан, Чжиюань Ху, Юньхуа Чжан и Лян Фан, 2020 г. « Исследование эксперимента по визуализации влияния диаметра сопла форсунки на характеристики воспламенения и сгорания дизельного двигателя «, Энергии, МДПИ, вып.13(20), страницы 1-18, октябрь.
    10. Цю, Тао и Дай, Хэфэй и Лей, Ян и Цао, Чунлей и Ли, Сючу, 2015 г. » Оптимизация профиля кулачка насоса электронного блока для дизельного двигателя большой мощности ,» Энергия, Эльзевир, том. 83(С), страницы 276-283.
    11. Чжан, Чжэн и Лю, Фушуй и Ван, Пей и Ху, Руо и Сун, Байган, 2017 г. « Методика параметрического проектирования профиля кулачка для насоса с электронным блоком ,» Энергия, Эльзевир, том. 139(С), страницы 170-183.
    12. Чжан, Чжифэй и Ли, Тие и Ши, Вэйцюань, 2019 г. « Ambient Tracer-LIF для двухмерного количественного измерения концентрации топлива в газовых форсунках ,» Энергия, Эльзевир, том. 171(С), страницы 372-384.
    13. О, Чонсон и Но, Донсун, 2015 г. » Характеристики пламени кислородно-топливной струи без предварительного смешения в лабораторной печи ,» Энергия, Эльзевир, том. 81(С), страницы 328-343.
    14. Ма, Сяо и Сюй, Хунмин и Цзян, Чанчжао и Шуай, Шицзинь, 2014 г.» Сверхскоростная визуализация и исследование OH-LIF горения ДМФ и МФ в оптическом двигателе DISI ,» Прикладная энергия, Elsevier, vol. 122(С), страницы 247-260.
    15. да Кошта, Роберто Берлини Родригес и Родригес Филью, Фернандо Антонио и Морейра, Тьяго Аугусто Араужо и Баэта, Хосе Гильерме Коэльо и Гуццо, Марсио Экспедито и де Соуза, Хосе Леонсио Фонсека, 2020. » Исследование предела обедненной смеси и улучшение расхода топлива системы зажигания с форкамерой гомогенного заряда в двигателе SI, работающем на смеси бензина и биоэтанола ,» Энергия, Эльзевир, том.197(С).
    16. Пайри, Рауль и Химено, Хайме и Барди, Микеле и Плазас, Алехандро Х., 2013 г. « Исследование результатов проникновения жидкости по длине, полученных с помощью пьезоэлектрического инжектора прямого действия ,» Прикладная энергия, Elsevier, vol. 106(С), страницы 152-162.
    17. Ву, Хорнг-Вен и Ву, Чжан-И, 2012 г. « Определение характеристик сгорания и оптимальных коэффициентов методом Тагучи для дизельных двигателей с впрыском водорода во впускные каналы ,» Энергия, Эльзевир, том. 47(1), страницы 411-420.
    18. Коста, М. и Катапано, Ф. и Семента, П. и Зорге, У. и Вальеко, Б.М., 2016. « Приготовление смеси и сгорание в двигателе GDI при стехиометрическом или бедном заряде: экспериментальное и численное исследование оптически доступного двигателя ,» Прикладная энергия, Elsevier, vol. 180(С), страницы 86-103.
    19. Ван, Хайоу и Луо, Кун и Фан, Цзяньрен, 2012 г. » Прямое численное моделирование и проверка подмодели CMC (условное замыкание момента) горения струи ,» Энергия, Эльзевир, том.46(1), страницы 606-617.
    20. Иримеску, Адриан, 2011 г. » Эффективность преобразования топлива двигателя с впрыском через порт, работающего на смесях бензина и изобутанола ,» Энергия, Эльзевир, том. 36(5), страницы 3030-3035.

    Исправления

    Все материалы на этом сайте предоставлены соответствующими издателями и авторами. Вы можете помочь исправить ошибки и упущения. При запросе исправления укажите дескриптор этого элемента: RePEc:eee:energy:v:73:y:2014:i:c:p:59-69 .См. общую информацию о том, как исправить материал в RePEc.

    По техническим вопросам, касающимся этого элемента, или для исправления его авторов, названия, реферата, библиографической информации или информации для загрузки, обращайтесь: . Общие контактные данные поставщика: http://www.journals.elsevier.com/energy .

    Если вы создали этот элемент и еще не зарегистрированы в RePEc, мы рекомендуем вам сделать это здесь. Это позволяет связать ваш профиль с этим элементом. Это также позволяет вам принимать потенциальные ссылки на этот элемент, в отношении которых мы не уверены.

    Если CitEc распознал библиографическую ссылку, но не связал с ней элемент в RePEc, вы можете помочь с помощью этой формы .

    Если вы знаете об отсутствующих элементах, ссылающихся на этот, вы можете помочь нам создать эти ссылки, добавив соответствующие ссылки таким же образом, как указано выше, для каждого ссылающегося элемента. Если вы являетесь зарегистрированным автором этого элемента, вы также можете проверить вкладку «Цитаты» в своем профиле RePEc Author Service, так как некоторые цитаты могут ожидать подтверждения.

    По техническим вопросам относительно этого элемента или для исправления его авторов, названия, реферата, библиографической информации или информации для загрузки обращайтесь: Кэтрин Лю (адрес электронной почты доступен ниже). Общие контактные данные поставщика: http://www.journals.elsevier.com/energy .

    Обратите внимание, что фильтрация исправлений может занять пару недель. различные услуги RePEc.

    Характеристики массопереноса газ–жидкость при промывке авиационного топлива в топливном баке самолета

    Физическая модель

    Схематическая диаграмма топливного бака в масштабе представлена ​​на рис.1, а размер трехмерной модели составляет 300 × 200 × 100 мм 3 . Бак заполняется авиационным топливом до заданного уровня. Затем NEA впрыскивается в авиационное топливо из впускного барботера на дне топливного бака, образуя крошечные пузырьки, которые рассеиваются по всей жидкости.

    Рисунок 1

    Схематическое изображение увеличенного топливного бака.

    Математическая модель

    Уравнения сохранения

    Двухжидкостная модель Эйлера–Эйлера подходит и широко используется в CFD-моделировании переноса массы в прямом контакте газ–жидкость 22,23 .В двухжидкостной модели Эйлера-Эйлера жидкость как непрерывная фаза перемежается диспергированным газом. Каждая фаза в модели многофазного потока решается с помощью набора уравнений импульса и моделей уравнений неразрывности. Уравнения сохранения для модели Эйлера – Эйлера показаны ниже.

    Уравнение сохранения массы для газовой или жидкой фазы может быть выражено следующим образом: {i}}} ) + \nabla (\rho_{{\text{i}}} \alpha_{{\text{i}}} {\mathbf{u}}_{{\text{i}}} ) = 0 $$

    (1)

    Закон сохранения импульса для обеих фаз можно записать как:

    $$ \frac{\partial }{{\partial t}}(\rho _{{\text{i}}} \alpha _{{\text{i}}} {\mathbf{u}}_ {{\text{i}}} ) + \nabla \cdot (\rho _{{\text{i}}} \alpha _{{\text{i}}} {\mathbf{u}}_{i } {\ mathbf {u}} _ {i} ) = — \ alpha _ {i} \ nabla p + \ nabla \ cdot \ left [ {\ alpha _ {i} \ mu _ {{\ text {i}} } (\nabla {\mathbf{u}}_{i} + \nabla {\mathbf{u}}_{i} ^{{\text{T}}} )} \right] + \alpha _{i } \rho _{i} {\mathbf{g}} + {\mathbf{R}}_{{i{\text{j}}}}$$

    (2)

    R ij — сила на границе раздела между газом и жидкостью, которая в основном включает силу сопротивления, подъемную силу и силу виртуальной массы.{{{\text{DF}}}} = \frac{3}{4}\rho_{l} \alpha_{g} \frac{{C_{{\text{D}}} }}{{d_{ {\ text {B}}} }} ({\ mathbf {u}} _ {g} — {\ mathbf {u}} _ {l}) | {\ mathbf {u}} _ {g} — {\ mathbf{u}}_{l} | $$

    (4)

    где ( u g u l ) – скорость скольжения между газом и жидкостью. C D определяется пузырьковым числом Рейнольдса и числом Эотвоша, которое представлено как 14,24 :

    $$ C_{{\text{D}}} = \max \left( {\min \left( {\ frac {24} {{Re}} (1 + 0.{{{\text{FL}}}} = \alpha_{{\text{g}}} \rho_{{\text{l}}} C_{{\text{L}}} ({\mathbf{u }}_{g} — {\mathbf{u}}_{l} ) \times \nabla \times {\mathbf{u}}_{l} $$

    (8)

    где C L — коэффициент подъемной силы со значением 0,5 27 .

    Сила виртуальной массы — это сила, действующая на окружающую жидкость в результате ускоренного движения пузырька, и может быть выражена как:

    $$ {\mathbf{R}}_{{\text{l}}}^{ {{\text{VMF}}}} = C_{{{\text{VM}}}} \rho_{{\text{l}}} \alpha_{{\text{g}}} \left( {\ frac{{{\text{d}}{\mathbf{u}}_{{\text{g}}} }}{{{\text{d}}t}} — \frac{{{\text{ d}}{\mathbf{u}}_{{\text{l}}} }}{{{\text{d}}t}}} \right) $$

    (9)

    где C VM — виртуальный массовый коэффициент с заданным значением 0.5 для получения точных результатов 28 .

    Модель турбулентности

    Основная функция модели турбулентности заключается в решении уравнения турбулентного движения жидкости путем связывания новых неизвестных со средним градиентом скорости. В литературе было разработано множество моделей турбулентности 29,30 , и две модели уравнений являются наиболее простыми моделями турбулентности для получения кинетической энергии турбулентности в масштабе скорости k и коэффициента диссипации в масштабе длины турбулентности ε путем решения двух дополнительных транспортные уравнения 31 . Стандартная модель k ε широко используется в научных кругах и промышленности из-за ее преимуществ в надежности, экономичности и точности вычислений 32,33 . Стандартная модель k ε может быть выражена следующим образом: }}} k_{{\text{l}}} ) + \nabla (\alpha_{{\text{l}}} \rho_{{\text{l}}} {\mathbf{u}}_{{ \text{l}}} k_{{\text{l}}} ) = \nabla \cdot (\alpha_{{\text{l}}} (\mu + \frac{{\mu_{{\text{ t}}} }}{{\omega_{k} }})\nabla k_{{\text{l}}} ) + \alpha_{{\text{l}}} (P_{k} — \rho_{ {\text{l}}} \varepsilon_{{\text{l}}} ) $$

    (10)

    $$ \frac{\partial }{\partial t}(\alpha_{{\text{l}}} \rho_{{\text{l}}} \varepsilon_{{\text{l}}} ) + \nabla (\alpha_{{\text{l}}} \rho_{{\text{l}}} {\mathbf{u}}_{{\text{l}}} \varepsilon_{{\text{ l}}} ) = \nabla \cdot (\alpha_{{\text{l}}} (\mu + \frac{{\mu_{{\text{t}}} }}{{\omega_{\varepsilon } }})\nabla \varepsilon_{{\text{l}}} ) + \alpha_{{\text{l}}} \frac{{\varepsilon_{{\text{l}}} }}{{k_ {{\text{l}}} }}(C_{1} P_{k} — C_{2} \rho_{{\text{l}}} \varepsilon_{l} ) $$

    (11)

    где ω k , ω ε , C 1 и C 2 могут быть установлены равными 1.{\prime}_{{\text{i}}} {\text{) + }}S_{{\text{i}}}$$

    (13)

    Во время очистки изменение парциального давления кислорода и азота приводит к массообмену кислорода и азота между пузырьком NEA и авиационным топливом.Его можно выразить следующим образом:

    $$ S_{{\text{O}}} = K_{{\text{O}}} a(c_{{\text{s,O}}} — c_{{\ текст {O}}} ) $$

    (14)

    $$ S_{{\text{N}}} = K_{{\text{N}}} a(c_{{\text{s,N}}} — c_{N} ) $$

    (15)

    Концентрацию насыщения O 2 и N 2 в авиационном топливе можно определить по коэффициенту Оствальда, который представляет собой объем газа, растворенного в объеме жидкости при заданных парциальном давлении газа и температуре.Коэффициент Оствальда 34 может быть выражен как: 0,639(700 — T)}{T}ln(3,333L_{0} )\right] $$

    (16)

    где L 0 — коэффициент Оствальда при 0 ℃ для нефтяных жидкостей с 2 соответственно.{\ гидроразрыв{1}{3}} $$

    (19)

    Классическая теория проникновения 35 применяется для определения коэффициента массообмена и выражается как:

    $$ K_{{\text{O}}} = 2\sqrt {\frac{{D_{{\text {O}}} u_{{\text{r}}} }}{{\pi d_{{{\text{bs}}}} }}} $$

    (20)

    $$ K_{{\text{N}}} = 2\sqrt {\frac{{D_{{\text{N}}} u_{{\text{r}}}}}{{\pi d_ {{{\text{bs}}}} }}} $$

    (21)

    Коэффициент массовой диффузии тесно связан с вязкостью, температурой и другими факторами 36,37 .{- 14} Т) $$

    (23)

    Клинические характеристики 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 года, в Ухане, Китай | Медицина интенсивной терапии | ДЖАМА

    Ключевые моменты

    Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 года (NCIP), в Ухане, Китай?

    Находки В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов нуждались в госпитализации в отделение интенсивной терапии и 4.3% умерли. Предполагаемая внутрибольничная передача 2019-nCoV от человека к человеку была заподозрена у 41% пациентов.

    Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой внутрибольничной передачей, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

    Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличилось, но информация о клинических характеристиках пораженных пациентов ограничена.

    Цель Описать эпидемиологические и клинические характеристики NCIP.

    Дизайн, сеттинг и участники Ретроспективная одноцентровая серия случаев из 138 последовательно госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г.; окончательная дата наблюдения — 3 февраля 2020 г.

    Воздействие Документированный НКИП.

    Основные результаты и показатели Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, рентгенологические данные и данные о лечении. Исходы пациентов в критическом состоянии и пациентов в некритическом состоянии сравнивались. Предполагаемая внутрибольничная передача подозревалась, если заражалась группа медицинских работников или госпитализированных пациентов в одних и тех же отделениях и можно было отследить возможный источник инфекции.

    Результаты Среди 138 госпитализированных пациентов с NCIP средний возраст составил 56 лет (межквартильный диапазон 42-68 лет, диапазон 22-92 года), 75 (54,3%) были мужчинами. Внутрибольничная передача подозревалась в качестве предполагаемого механизма заражения пострадавших медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали лихорадку (136 [98,6%]), утомляемость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (число лимфоцитов, 0,8 × 10 9 /л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), удлинение протромбинового времени (13,0 секунд [МКИ, 12,3-13,7]) у 80 пациентов (58%) и повышение уровня лактатдегидрогеназы (261 Ед/л [МКИ, 182-182%). 403]) у 55 больных (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или непрозрачность по типу «матового стекла» в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18.4%].1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение реанимации и интенсивной терапии (ОИТ) из-за осложнений, в том числе острого респираторного дистресс-синдрома (22 [61,1%]), аритмии (16 [44,4%]) и шока (11 [30,6%]). %]). Среднее время от первого симптома до появления одышки составило 5,0 дней, до госпитализации — 7,0 дней, до ОРДС — 8,0 дней. Пациенты, получавшие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не получавшими лечения в отделении интенсивной терапии (n = 102), были старше (медиана возраста 66 лет против 51 года), чаще имели сопутствующие заболевания (26 [72.2%] по сравнению с 38 [37,3%]), и чаще страдали одышкой (23 [63,9%] по сравнению с 20 [19,6%]) и анорексией (24 [66,7%] по сравнению с 31 [30,4%]). Из 36 больных в ОИТ 4 (11,1%) получали высокопотоковую оксигенотерапию, 15 (41,7%) — неинвазивную вентиляцию легких, 17 (47,2%) — инвазивную вентиляцию легких (4 переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля выписано 47 пациентов (34,1%), умерло 6 (общая летальность 4,3%), но остальные пациенты остаются на стационарном лечении. Среди выписанных живыми (n = 47) медиана пребывания в стационаре составила 10 дней (IQR, 7.0-14,0).

    Выводы и актуальность В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая внутрибольничная передача 2019-nCoV была заподозрена у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

    Quiz Ref IDВ декабре 2019 г. в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, теперь известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 г. в Китае было подтверждено в общей сложности 9692 случая NCIP. На международном уровне случаи были зарегистрированы в 24 странах и на 5 континентах. 6 3 января 2020 г. новый коронавирус 2019 г. (2019-nCoV) был обнаружен в образцах жидкости бронхоальвеолярного лаважа у пациента в Ухане и подтвержден как причина NCIP. 7 Полное секвенирование генома и филогенетический анализ показали, что 2019-nCoV является кладой, отличной от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (ТОРС) и ближневосточным респираторным синдромом (БВРС) человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и относится к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что распространение среди людей произошло в результате передачи от диких животных, незаконно проданных на оптовом рынке морепродуктов Хуанань. 8

    Huang et al 9 впервые сообщили о 41 случае NCIP, в которых большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Huanan.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальный или сниженный уровень лейкоцитов и рентгенологические признаки пневмонии. Органная дисфункция (например, шок, острый респираторный дистресс-синдром [ОРДС], острая сердечная недостаточность и острая почечная недостаточность) и смерть могут наступить в тяжелых случаях. 9 Впоследствии Chen et al. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. и может привести к ОРДС.Однако о разнице в клинических характеристиках между тяжелыми и нетяжелыми случаями не сообщалось. Сообщения о случаях заболевания подтвердили передачу NCIP от человека к человеку. 10 ,11 В настоящее время не существует эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ОИТ), с нетяжелыми случаями, которые не получали помощь в ОИТ.

    Дизайн исследования и участники

    Quiz Ref IDЭта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). В исследование были включены все последовательные пациенты с подтвержденным NCIP, поступившие в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 года.От пациентов было получено устное согласие. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из крупнейших третичных учебных больниц и отвечает за лечение NCIP, назначенное правительством. Все пациенты с NCIP, включенные в это исследование, были диагностированы в соответствии с временным руководством Всемирной организации здравоохранения. 12 Клинические исходы (например, выписка, смертность, продолжительность пребывания в стационаре) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

    Медицинские карты пациентов были проанализированы исследовательской группой отделения интенсивной терапии больницы Чжуннань Уханьского университета. Эпидемиологические, клинико-лабораторные и рентгенологические характеристики, а также данные о лечении и исходах были получены с помощью форм сбора данных из электронных медицинских карт. Данные были проверены обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, основные сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, терапию кортикостероидами, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, КТ грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острая почечная недостаточность была идентифицирована в соответствии с определением болезни почек: улучшение глобальных результатов. 14 Сердечная травма определялась, если сывороточные уровни сердечных биомаркеров (например, тропонина I) превышали верхний референтный предел 99-го процентиля или при электрокардиографии и эхокардиографии обнаруживались новые отклонения. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии были определены баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического состояния здоровья II. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и госпитализации в ОИТ.

    Подозрение на внутрибольничную передачу возникало, если группа медицинских работников или госпитализированных пациентов в одних и тех же отделениях заражалась в течение определенного периода времени и можно было отследить возможный источник инфекции.

    Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

    Было собрано

    образца мазка из горла для выделения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора со 150 мкл раствора для сохранения вируса, и тотальную РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторных образцов (Чжунчжи, Ухань, Китай).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим встряхиванием в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об/мин в течение 5 минут. Суспензию использовали для анализа полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) в реальном времени РНК 2019-nCoV. Два целевых гена, включая открытую рамку считывания 1ab ( ORF1ab ) и нуклеокапсидный белок (N), одновременно амплифицировали и тестировали в ходе анализа ОТ-ПЦР в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Анализ ОТ-ПЦР в реальном времени проводили с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров Probe, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ ОТ-ПЦР проводили в следующих условиях: инкубация при 50 °С в течение 15 минут и при 95 °С в течение 5 минут, 40 циклов денатурации при 94 °С в течение 15 секунд, удлинение и сбор сигнала флуоресценции при 55 °С в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 определялось как положительный результат теста, а значение Ct 40 или более определялось как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

    Категориальные переменные были описаны как частоты и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианы и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием независимых групповых тестов t , когда данные были распределены нормально; в противном случае использовался критерий Манна-Уитни.Данные (ненормальное распределение) повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Доли категориальных переменных сравнивались с использованием критерия χ 2 , хотя при ограниченности данных использовался точный критерий Фишера. Все статистические анализы проводились с использованием программного обеспечения SPSS (Statistical Package for the Social Sciences) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двустороннее значение α менее 0,05 считалось статистически значимым. Анализы не были скорректированы для множественных сравнений, и, учитывая возможность ошибки I рода, результаты следует интерпретировать как исследовательские и описательные.

    Представление характеристик

    Исследуемая популяция включала 138 госпитализированных пациентов с подтвержденным NCIP. Медиана возраста составила 56 лет (МКР 42-68 лет, диапазон 22-92 года), 75 (54,3%) мужчин. Из них 102 (73,9%) больных были госпитализированы в изолятор, а 36 (26.1%) были госпитализированы и переведены в ОРИТ в связи с развитием органной дисфункции (табл. 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составила 5 дней (IQR, 1–10), 7 дней (IQR, 4–8) и 8 дней (IQR, 6–12) соответственно (таблица 1). ). Из 138 пациентов 64 (46,4%) имели 1 или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее распространенными сопутствующими состояниями.

    Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), утомляемость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (таблица 1). В общей сложности у 14 пациентов (10,1 %) первоначально развились диарея и тошнота за 1–2 дня до развития лихорадки и одышки.

    По сравнению с пациентами, которые не получали помощь в отделении интенсивной терапии (n = 102), пациенты, нуждавшиеся в помощи в отделении интенсивной терапии (n = 36), были значительно старше (медиана возраста 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37-78]. 62]; P  < .001) и чаще имели сопутствующие заболевания, включая гипертонию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%]), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярные заболевания (6 [16,7%] против 1 [1,0%]). боль и анорексия

    Показатели жизнедеятельности и лабораторные параметры в ОИТ и у пациентов, не находящихся в ОИТ

    Частота сердечных сокращений, частота дыхания и среднее артериальное давление не отличались между пациентами, получавшими помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в стационар для всех пациентов, затем разделялись на тех, кто впоследствии был госпитализирован в ОИТ или нет. Были многочисленные различия в лабораторных данных между пациентами, поступившими в отделение интенсивной терапии, и пациентами, не госпитализированными в отделение интенсивной терапии (таблица 2), включая более высокое количество лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 зарегистрированных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до госпитализации в ОИТ составило 10 дней (межквартильный интервал 6–12) (таблица 3).Медиана шкалы комы Глазго в день поступления в отделение интенсивной терапии; Острая физиология и оценка хронического состояния здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9–15), 17 (IQR, 10–22) и 5 ​​(IQR, 3–6) соответственно (таблица 3). Среднее значение парциального давления кислорода составило 68 мм рт. ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составила 136 мм рт. ст. (IQR, 103–234).

    Органные дисфункции и основные вмешательства

    Органная дисфункция и лечение 138 пациентов показаны в Таблице 4.По состоянию на 3 февраля 2020 г. в стационаре остаются 85 пациентов (61,6%). Всего выписано 47 пациентов (34,1%), умерло 6 пациентов (4,3%). Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты, 6 умерли. Из 11 пациентов, оставшихся в ОРИТ, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​на неинвазивную вентиляцию легких). Общие осложнения среди 138 пациентов включали шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмия (23 [16,7%]) и острое повреждение сердца (10 [7,2%]). Пациенты, получавшие помощь в ОИТ, чаще имели одно из этих осложнений, чем пациенты, не получавшие ОИТ.

    Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород и 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная искусственная вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых в качестве экстренной терапии получили экстракорпоральную мембранную оксигенацию. Вазопрессоры получали 13 пациентов, заместительную почечную терапию получали 2 пациента.

    Динамический профиль лабораторных показателей у пациентов с NCIP

    Для определения основных клинических особенностей, возникающих при прогрессировании НКИП, отслеживали динамическую динамику 6 клинико-лабораторных показателей, включая гематологические и биохимические показатели, с 1-го по 19-й день от начала заболевания с интервалом в 2 дня.На конец 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов отмечалась выраженная лимфопения, а у невыживших со временем развилась более тяжелая лимфопения. Количество лейкоцитов и количество нейтрофилов было выше у невыживших, чем у выживших. Уровень D-димера был выше у невыживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического состояния уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

    Предполагаемая внутрибольничная передача и инфекция

    Из 138 пациентов 57 (41,3%) предположительно заразились в стационаре, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 из внутренних болезней и 5 из онкологического отделения.Из инфицированных медицинских работников 31 (77,5%) работали в общих палатах, 7 (17,5%) в отделении неотложной помощи и 2 (5%) в отделении интенсивной терапии. Один пациент в текущем исследовании имел абдоминальные симптомы и был госпитализирован в хирургическое отделение. Предполагалось, что более 10 медицинских работников этого отделения заразились от этого пациента. Также предполагалось, что имела место передача от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одном отделении были инфицированы, и у всех были атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем больной был изолирован. Впоследствии у других 3 пациентов в том же отделении была лихорадка, абдоминальные симптомы, и у них была диагностирована инфекция nCoV.

    Quiz Ref IDЭтот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализации пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% выписаны, 6 умерли (4,3%), 61,6% остаются в больнице. Для тех, кто был выписан (n = 47), пребывание в стационаре составило 10 дней (IQR, 7,0-14,0). Время от начала до одышки составило 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Общими симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально были атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачности матового стекла было типичным признаком КТ для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась оксигенотерапия, и меньшинство пациентов нуждалось в инвазивной вентиляции или даже в экстракорпоральной мембранной оксигенации.

    Quiz Ref IDДанные этого исследования позволяют предположить, что могла иметь место быстрая передача 2019-nCoV от человека к человеку. Основная причина вытекает из оценки основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется на новых людей, она воспроизводит себя; R 0 указывает среднее число дополнительных лиц, которых один больной заражает в течение болезни, и конкретно относится к популяции людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что означает, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с атипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

    Недавнее исследование показало, что nCoV был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако сложно дифференцировать и проводить скрининг пациентов с атипичными симптомами. Тем не менее, быстрая передача инфекции от человека к человеку при тесных контактах является важной особенностью пневмонии, вызванной nCoV. 10 ,11,15

    Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не находящимися в ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками мужского пола.По сравнению с симптомами у пациентов, не находившихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам выявить пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому, что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи относятся к стадия вспышки.

    Наиболее распространенными лабораторными отклонениями, наблюдаемыми в этом исследовании, были снижение общего числа лимфоцитов, удлинение протромбинового времени и повышение уровня лактатдегидрогеназы. По сравнению с пациентами, не находившимися в отделении интенсивной терапии, у пациентов, получавших помощь в отделении интенсивной терапии, были многочисленные лабораторные отклонения. Эти аномалии предполагают, что инфекция 2019-nCoV может быть связана с дефицитом клеточного иммунитета, активацией коагуляции, повреждением миокарда, поражением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией MERS-CoV и SARS-CoV.

    Динамический профиль лабораторных данных прослежен у 33 пациентов с NCIP (5 невыживших и 28 выживших). У невыживших продолжали увеличиваться количество нейтрофилов, D-димера, мочевины и креатинина в крови, а количество лимфоцитов продолжало снижаться до тех пор, пока не наступила смерть. Нейтрофилия может быть связана с цитокиновым штормом, вызванным инвазией вируса, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

    Quiz Ref IДо сих пор не было рекомендовано никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этому заболеванию заключается в контроле источника инфекции; использование средств индивидуальной защиты для снижения риска передачи инфекции; и ранняя диагностика, изоляция и поддерживающее лечение пострадавших пациентов. Антибактериальные средства малоэффективны.Кроме того, не было обнаружено никаких противовирусных средств, полезных для лечения SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировала в зависимости от тяжести заболевания. Однако эффективных результатов не наблюдалось.

    Это исследование имеет несколько ограничений. Во-первых, образцы из дыхательных путей использовались для диагностики NCIP с помощью RT-PCR.Сыворотки больных для оценки виремии не получали. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, внутрибольничная передача/инфекция не могла быть окончательно доказана, но подозревалась и предполагалась на основании времени и моделей контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, среди 138 случаев большинство пациентов все еще находятся в больнице на момент подачи рукописи.Поэтому трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением заболевания.

    В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая внутрибольничная передача 2019-nCoV была заподозрена у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

    Авторы, переписывающиеся: Zhiyong Peng, MD, Отделение интенсивной терапии ([email protected]) и Xinghuan Wang, MD, Отделение урологии ([email protected]), Больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

    Принято к публикации: 3 февраля 2020 г.

    Опубликовано в сети: 7 февраля 2020 г. doi:10.1001/jama.2020.1585

    1 правильные данные для пациентов женского пола в таблице 1.

    Вклад авторов: Drs D.Ван и Пэн имели полный доступ ко всем данным исследования и брали на себя ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и разделили первое авторство. В подготовке этой статьи в равной степени участвовали доктора Пэн и X. Ван.

    Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

    Сбор, анализ или интерпретация данных: D. Wang, C. Hu, Zhu, Liu, Zhang, B. Wang, Xiang, Cheng, Xiong, Peng.

    Составление рукописи: Д. Ван, К. Ху, Сян, Сюн, Ли, Пэн.

    Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Ченг, Сюн, Чжао, С. Ван, Пэн.

    Статистический анализ: К. Ху, Чжу, Лю, Б. Ван, Сюн.

    Получено финансирование: Д. Ван, Пэн.

    Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

    Надзор: Б. Ху, Сюн, Чжао, С. Ван, Пэн.

    Раскрытие информации о конфликте интересов: Не сообщалось.

    Финансирование/поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 д-ру Д. Вану; гранты 81772046 и 81971816 д-ру Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарств в крупных национальных Научно-технические проекты Китая (2020ZX007, доктору Пэну).

    Роль спонсора/спонсора: Спонсоры не участвовали в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

    1.Лу Х, Стрэттон CW, Танг Ю.В. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi:10.1002/jmv.25678PubMedGoogle Scholar2.Hui ДС, я Ажар Э, Мадани ТА, и другие. Продолжающаяся эпидемическая угроза новых коронавирусов 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.].  Int J Infect Dis . 2020;91:264-266. doi:10.1016/j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван Вт, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . doi:10.1056/NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.].  Ланцет . doi:10.1016/S0140-6736(20)30211-7PubMedGoogle Scholar10.Chan JF-W, Юань С, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 г.].  Ланцет . 2020;S0140-6736(20)30154-9. doi:10.1016/S0140-6736(20)30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг КК, и другие. Импорт и передача нового коронавируса от человека человеку во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . дои: 10.1056/NEJMc2001272PubMedGoogle Scholar13.Ranieri ВМ, Рубенфельд ГД, Томпсон БТ, и другие; Целевая группа по определению ARDS. Острый респираторный дистресс-синдром: берлинское определение.  ДЖАМА . 2012;307(23):2526-2533. doi:10.1001/jama.2012.5669PubMedGoogle Scholar14.Заболевания почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Клиническое практическое руководство KDIGO при остром повреждении почек. Почки Int Suppl . 2012; 2:1. Google ScholarCrossref 15.Ли Кью, Гуань Х, Ву П, и другие. динамика ранней передачи в Ухане, Китай, пневмонии, инфицированной новым коронавирусом. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar16.Zhang Х, Кан ZJ, Гонг ХИ, и другие. Пищеварительная система является потенциальным путем заражения 2019 nCoV: биоинформатический анализ, основанный на транскриптомах отдельных клеток. Препринт. Размещено в сети 31 января 2020 г.bioRxiv 6. doi: 10.1101/2020.01.30.6 .

    Добавить комментарий

    Ваш адрес email не будет опубликован.