Лада 2019: LADA в 2019 году: новые модели и успехи Бренда — Новости

Содержание

Чем порадует АвтоВАЗ в 2020 году — Российская газета

В 2019 году российский бренд Lada расширил модельный ряд за счёт «заряженного» седана Vesta Sport, «вседорожного» универсала Granta Cross, «околоспортивной» Granta Drive Active и «автоматических» Xray Cross и семейства Vesta.

Дальше перед Волжским автогигантом стоят задачи по выпуску новых и обновлению текущих моделей Lada. Примечательно, что для разработки новых продуктов завод активно набирает инженеров-технологов, конструкторов и дизайнеров.

Ждать в текущем году выхода принципиально новых моделей Lada не стоит. Ведь в августе, по уже сложившейся традиции, марка завалит Московский автосалон своими премьерами.

Наверняка завод покажет серийную версию Niva, он же кроссовер повышенной проходимости, а также компактный городской SUV по мотивам XCode, «каблучок» с рабочим названием Van, концепт бюджетника Granta второго поколения, рестайлинговые Vesta FL и Xray FL. Выход новинок растянется на последующие два года, но пока спустимся с небес на землю, а именно в реалии 2020 года.

1. Lada 4×4 FL — обновление самой старой модели

В середине декабря 2019 года АвтоВАЗ запустил серийное производство обновлённой Lada 4×4 с заводским обозначением FL (Facelift). Первые товарные экземпляры модернизированной модели активно отгружают в дилерскую сеть, продажи должны стартовать в текущем месяце.

После обновления снаружи обычную Lada 4×4 с алюминиевыми бамперами можно идентифицировать только по наличию штатной антенны на крыше. Классические «нивовские» бампера останутся на некоторых версиях. Lada 4×4 в городской модификации Urban отличается передним бампером с интегрированными противотуманными фонарями. Также установлены новые опоры силового агрегата (снижающие уровень вибраций), улучшенный пакет шумо-виброизоляции на панелях кузова, ограничители и трёхкамерные уплотнители дверей.

Главное — Lada 4×4 FL получила новый интерьер. В салоне появилась оригинальная передняя панель с электронным блоком управления климатической установкой, увеличенными воздуховодами, вместительным бардачком, комбинацией приборов от Lada Priora (по стилистике схожа с Granta FL, Vesta, Xray). Внедорожник оснащается более удобными сиденьями с развитой боковой поддержкой и широким задним диваном с двумя подголовниками. Передние кресла имеют модернизированный механизм складывания и могут подогреваться, а водительское сиденье обзавелось боковой подушкой безопасности.

Наконец, внутреннее убранство может похвастать формованным потолком с солнцезащитными козырьками, плафоном освещения и блоком системы ЭРА-ГЛОНАСС, а также новой обивкой стоек лобового стекла, потолочными поручнями. Изменился и центральный тоннель, в котором присутствует ниша под смартфон, две розетки на 12В, подстаканники, блок электрической регулировки боковых зеркал, кнопки стеклоподъёмников и обогрева сидений.

По технике Lada 4×4 по-прежнему оснащается 1,7-литровым бензиновым двигателем мощностью 83 л.с. и пятиступенчатой механической коробкой передач.

Отметим, модернизация Lada 4х4 проходит в два этапа. Первый осуществлён, второй случится в нынешнем году. В рамках дальнейшего рестайлинга внедорожник должен обзавестись оригинальным рулевым колесом с подушкой безопасности (!), другой облицовкой рулевой колонки, дверными картами нового образца, более эргономичными рычагами управления коробкой передач, «блокировкой-понижайкой». Дело в том, что на момент премьеры обновлённого внедорожника у завода не хватило денег на установку той же фронтальной водительской подушки, а машину в производство надо было запускать.

Не исключено, что в комплексную модернизацию Lada 4×4 войдут и следующие предполагаемые доработки: автоматическое включение дворников при включении омывателя, замена самих форсунок, программируемая пауза работы стеклоочистителей, выключение ближнего света и габаритов при выключении зажигания. Инженеры намерены внедрить подлокотник сиденья водителя, фильтр для поступающего в салон воздуха, а также адаптировать обивки передних дверей для установки акустических динамиков, уменьшить загрязняемость ручки двери багажника, а цвет полки багажника приблизить к основному цвету отделки салона.

Надеяться на существенные улучшения по части техники не приходится. Хотя в своё время планировалось установить под капот Lada 4×4 1,6-литровый «атмосферник» и оснастить кнопкой электроблокировки дифференциала.

Объем нововведений зависит от финансовых успехов АвтоВАЗа. Завод действительно хочет улучшить легендарный внедорожник по многим параметрам, но серьёзное вмешательство в конструкцию машины советской разработки приведёт к удорожанию машины, а это неминуемо разрушит её рыночное преимущество.

Впрочем, времени у предприятия предостаточно, срок производства классической Lada 4×4 (Нива) продлен вплоть до 2026 года, когда модели исполнится 49 лет.

2. Largus FL — фейслифт лицензионной модели

Ещё одна модель, давно требующая к себе внимания — универсал Lada Largus. В линейке бренда Lada автомобиль появился в 2012 году и является лицензионной копией Dacia Logan MCV первого поколения 2006 года (!), адаптированной под российские условия. Доподлинно известно, что АвтоВАЗ активно работает над проектом фейслифта Lada Largus.

Изначально появление Largus FL ожидали к осени 2019 года, но в прошлом году было проведено лишь легкое обновление универсала, в рамках которого Largus получил решетку радиатора с двумя тонкими ламелями в новой стилистике марки.

Помимо этого, модель теперь имеет эмблему «ладьи» нового образца на решетке радиатора и ступице рулевого колеса, а также новый шильдик Lada (с большим расстоянием между буквами) на левой дверце багажника. Появились такие мелочи, как функция отключения головной светотехники при выключении зажигания, черное покрытие центральной стойки кузова, усиленная тонировка задней полусферы остекления, новая ткань обивки сидений.

Коммерческая модель Lada Largus показывает хороший уровень спроса и соответственно стабильные продажи. Поэтому завод не торопится с глубоким рестайлингом, который в итоге запланирован на 2020-2021 годы. Важным требованием Largus FL является то, что по стоимости он должен остаться в той же нише.

Универсал примерит новую переднюю часть кузова в Х-стиле, отражающую принадлежность к Lada Vesta, Xray и Granta FL. Появятся другие бамперы, иная оптика, решетка радиатора, возможно, изменится форма капота и передних боковых крыльев. Сбоку автомобиль должен остаться прежним. Ожидается, что после фейслифта автомобиль получит обновленный или полностью новый салон.

По технической части изменения вероятны. В прошлые годы звучали обещания начать оснащать Lada Largus 1,8-литровым двигателем (122 л.с.) с индексом ВАЗ-21179 и автоматической трансмиссией. По нашим данным, АвтоВАЗ задумывается над установкой на Lada Largus 122-сильного мотора, тем более, что ещё на стадии разработки агрегат рассчитывался для внедрения на Lada Vesta, Xray, непосредственно Largus и «Ниву» нового поколения. В качестве «бюджетной» альтернативы «автомата» тольяттинский автогигант может рассмотреть автоматизированную механическую трансмиссию («робот»). Подобный опыт уже испробован на соплатформенном Xray.

Кстати говоря, с момента выхода из всех агрегатных нововведений универсал удостоился лишь замены «реношных» двигателей на «вазовские». С октября 2017 года АвтоВАЗ начал продажи Lada Largus с 16-клапанным двигателем ВАЗ-21129.

106-сильный «атмосферник» вытеснил из гаммы мотор Renault K4M. В 2016-м завод заменил 84-сильный Renault K7M на ВАЗ-11189 мощностью 87 л.с. В Одобрении типа транспортного средства (ОТТС) за 2018 год в Lada Largus были зафиксированы изменения в виде установки 5-ступенчатой механической коробки передач с индексом ВАЗ-21809.

3. Vesta SW Sport — в погоне за седаном

Фото: Валерий Карташов/ РГ

Почти год назад, 31 января 2019 года, начались продажи седана Lada Vesta Sport. Модель стала самой дорогой серийной Lada в истории, но возможно это звание является временным. Давно сертифицирован универсал Vesta SW Sport, судьба которого напрямую зависит от успеха продаж спорт-седана.

Несмотря на наличие ОТТС и прототипов, компания находится в поиске рентабельной концепции для рынка. Всё зависит от окупаемости проекта, вложенных инвестиций и объёмов выпуска.

Известно, что проект Vesta SW Sport не закрыт и машина всё-таки увидит свет. Только в период с 31 января по 1 марта прошлого года официальные дилеры марки реализовали 217 экземпляров Vesta Sport (при годовом объёме в 1200 штук). Да, нужно дождаться итоговых цифр продаж седана за год. Но есть ощущение, что весь запланированный на 2019 год тираж Vesta Sport в большей степени реализован.

К тому же, степень унификации обвеса между двумя Sport-версиями составляет 100%, а значит завод не понесёт больших затрат на вывод перспективной новинки.

Так что вполне можно ждать «заряженного» универсала Vesta SW, которую множество количество раз замечали на дорожных тестах. Модель создаст вокруг себя новый класс автомобилей в бюджетном В-сегменте. По внешнему виду и доработкам шасси Vesta SW Sport полностью идентична Vesta Sedan Sport, с поправкой на тип кузова.

В остальном спорт-универсал будет схож со спорт-седаном и получит спортивный аэродинамический обвес, расширенную колею с передними пластиковыми крыльями, оригинальные 17-дюймовые диски на пяти болтах. В шасси появятся новые амортизаторы и стойки, тормоза с дисками увеличенного диаметра, заниженная подвеска с клиренсом в 162 мм.

В салоне установят новые сиденья с развитой боковой поддержкой, обновленную комбинацию приборов, черный потолок, атмосферную LED-подсветку, декоративные элементы под «карбон», накладки на педалях и порогах. Рулевое колесо, рукоятка коробки передач, ручник и подлокотник будут отделаны кожей.

Как и седан Vesta Sport, универсал Vesta SW Sport оснастят 1,8-литровым двигателем, мощностью 145 л.с. и крутящим моментом 187 Нм. Доработанный мотор отличается новыми распредвалами с измененным профилем (увеличен подъем кулачков), повышенным давлением в топливной системе и оригинальной калибровкой контроллера. Силовой агрегатируется с 5-ступенчатой механической коробкой передач JR5. Максимальная скорость спорт-седана составляет 198 км/ч, время разгона до 100 км/ч — 9,6 секунды.

Стоит напомнить, ещё в 2017 году АвтоВАЗ зарегистрировал новые товарные знаки — Vesta S-Line и Vesta R.

По аналогии с другими автомобильными компаниями можно предположить, что под приставкой S-Line завод «скрывает» «лайтовую» версию Vesta Sport в агрессивном обвесе, с той же спортивной подвеской, но без форсированного мотора.

С Vesta R дилемма. Vesta Sport оснащается 145-сильным двигателем, тогда приставку R должна получить самая мощная модификация Vesta. По слухам, рассматривается «форсировка» 1,8-литрового мотора до 180 л.с и установка турбомотора от Альянса Renault-Nissan-Mitsubishi серии H5Ht 1.3 TCe 150. К слову, обычно литера «R» в названиях моделей подразумевает и установку нового обвеса, а также глубокую перенастройку иных узлов, вроде подвески, трансмиссии и др.

4. Vesta FL — рестайлинг флагмана

25 ноября 2019 года стартовали продажи Lada Vesta с долгожданной связкой бесступенчатой автоматической трансмиссией Jatco JF015E и двигателем Renault h5Mk объемом 1,6 литра (113 л.с.). Некое промежуточное обновление случилось спустя ровно четыре года после начала продаж модели.

За это время семейство Vesta успело пополниться седаном, универсалом, их кросс-версиями, модификациями с приставкой CNG и Sport. Lada Vesta получила ряд опций и доработок, было устранено большинство «детских болячек», вроде посторонних звуков в подвеске, а также установлен новый стабилизатор, новые ограничители дверей и многое другое.

С появлением новой модификации Lada Vesta AT впервые в истории бренда Lada стал применяться электропривод складывания зеркал. Появились обогрев рулевого колеса, бескаркасные щетки стеклоочистителя, более глубокие подстаканники, чёрный потолок, функция подсветки поворотов и атмосферная подсветка салона, обычные седаны теперь оснащаются антенной «акулий плавник» и задним диваном со встроенным подлокотником. Цветовая гамма семейства пополнилась долгожданной сине-голубой эмалью «Дайвинг» и свежим черным цветом «Маэстро».

На этом АвтоВАЗ не собирается останавливаться. К 5-летнему юбилею Vesta необходимо кардинальным образом подготовить. Обновить внешность, изменить салон и поставить резвый мотор.

Всё это может исполниться уже в конце 2020 года или в начале 2021 года. «Российская газета» склоняется к текущему году и датам 25 сентября (дата серийного производства) или 25 ноября (дата старта продаж), когда модели исполнится пять лет и пора будет устроить полноценный рестайлинг.

Lada Vesta с заводским обозначением Facelift получит обновлённый дизайн экстерьера и абсолютно новый интерьер. Под капотом прогнозируется появление вышеописанного 1,3-литрового турбомотора (150 л.с.) от Renault Arkana.

Предполагается, что у Lada Vesta FL появятся новые бампера, фары и фонари, решетка радиатора, крышка багажника иной формы, при этом боковая часть кузова останется прежней. Машину оснастят обновлённым блоком управления стеклоподъёмниками с авторежимом, а форсунки стеклоомывателя «переедут» с капота на «жабо» автомобиля.

В рамках фейслифта Lada Vesta обзаведется полностью оригинальной передней панелью с современной архитектурой, дверными картами и центральным тоннелем пола. Особенностью интерьера станет огромный «парящий» тачскрин мультимедийной системы, который объединен с блоком климатической установки. В нижней части центральной консоли будет предусмотрена большая ниша для смартфона (станет доступна опция беспроводной зарядки).

Изменится дизайн селектора механической коробки передач, возле закрытой секции с подстаканниками (как на автомобилях классом выше) будет кнопка электронного ручника и шайба-селектора выбора режима движения Lada Ride Select. Сиденья останутся прежними, но в них должен поменяться угол наклона подушки, подлокотник станет регулируемым, рулевое колесо сменит дизайн и станет меньшего диаметра, на панели будет доступна кнопка «старт-стоп», в комбинации приборов будет отображаться два колодца и большой дисплей бортового компьютера.

Поменяется также форма воздуховодов, ручек открывания дверей и декоративных элементов, в боковинах центрального тоннеля появятся кармашки для мелочёвки.

комплектации и цены, фото, адреса дилеров Lada

Седан

Lada Vesta Sport
седан
поколение 2019 г.

Хэтчбек

Lada Granta
5-дверный хэтчбек
поколение 2018 г. Lada XRAY
5-дверный хэтчбек
поколение 2015 г. Lada XRAY Cross
5-дверный хэтчбек
поколение 2018 г.

Универсал

Lada Granta
универсал
поколение 2018 г. Lada Largus
универсал
поколение 2021 г.

Внедорожник

Lada Niva Legend
3-дверный внедорожник
поколение 1994 г. Lada Niva Legend
5-дверный внедорожник
поколение 1995 г. Lada Niva
5-дверный внедорожник
поколение 2020 г. Lada Niva Travel
5-дверный внедорожник
поколение 2021 г.

Как делают Lada Niva Travel? Раскрыты все подробности — журнал За рулем

За почти 20 лет в производство внесли больше 25 000 улучшений.

Материалы по теме

Автомобили Lada Niva Travel выпускают на предприятии в Тольятти, которое раньше называлось GM-AVTOVAZ, а в декабре 2019 года стало дочерней компанией АВТОВАЗа и теперь называется «Лада Запад Тольятти» (ЛЗТ). Ресурс «На заводе» рассказал о том, как на этом заводе собирают автомобили.

На территории более 137 тысяч квадратных метров расположены цеха окраски, сборки и вспомогательные, а также площадка, где идет подготовка к отгрузке и административный корпус. На заводе имеется более 1984 единиц технологического оборудования. Производство довольно компактное, кузова в сборе и основные агрегаты поставляются с АВТОВАЗа, протяженность конвейера составляет 481 метр.

Серийное производство автомобиля Chevrolet Niva здесь началось в 2002 году. За эти годы работники внедрили более 25 тысяч различных изменений, повлиявших на  эргономику, производственную инфраструктуру, производительность и автоматизацию. Например, здесь есть green zone — зоны, где рабочие трудятся сидя в креслах, так удобнее выполнять операции под днищем автомобиля.

С 2016 года платформу с кузовом собираемого автомобиля, вес которой составляет более полутора тонн, перемещает между линиями специально модифицированный штабелер, исключающий физические усилия. А в 2017 году на стациях установки колес появились пневматические манипуляторы, которые помогают снимать колеса со стеллажей и ставить на машину.

Кроме того, сейчас на сборке работают четыре роботизированные тележки, которые перевозят двери на линию подсбора. Когда их не было, платформы с дверьми перемещали люди. А уже в 2020 году на окраске кузовов внедрили систему SSAR (соблюдение запланированного порядка), и теперь можно отслеживать выполнение конкретных заказов по цветам и комплектациям.

С 2002 года завод выпустил более 750 000 автомобилей, при этом внедорожников Niva Travel с декабря 2020 года уже успели сделать свыше 6000 единиц.

  • А вот производство предыдущей версии, модели Lada Niva, выпускавшейся с лета 2020 года, окончательно свернули в марте 2021-го.

Фото: na-zavode.ru

Аренда авто в Красноярске | 🚗 Рента-Кар

 Современному деловому человеку или любознательному путешественнику сейчас трудно обойтись без автотранспорта, ведь мобильность, которую дает автомобиль, позволяет успеть на встречи, назначенные с небольшим запасом времени в разных частях города, без лишней суеты и усталости, осмотреть много достопримечательностей – и в городе, и даже в пригороде. Для таких людей, которые привыкли всегда и всюду успевать, лучшим выходом считается машина под аренду – легкий, доступный, рациональный способ лично перемещаться по городу или региону, а также без проблем подвозить документы, знакомых, грузы. Аренда автомобиля посуточно – это отличный выбор для поездки на деловую встречу.

Аренда и прокат авто в Красноярске по отличным ценам.

Преимущества проката авто, нельзя недооценить. В первую очередь, это значительно выгоднее, чем, например, пользоваться такси, в особенности если машиной предполагается пользоваться долгосрочный период времени, и это позволяет не чувствовать зависимость от расписания движения городского транспорта. При этом автолюбитель волен выбрать машину на свой вкус и согласно своим потребностям. Сегодня такая удобная услуга аренды, проката авто без водителя доступна во всех крупных городах. В частности, для всех желающих открыт прокат автомобилей в Красноярске – с широким выбором современных автомобилей и выгодными условиями аренды. Все, что необходимо для заключения сделки – минимальный пакет документов, немного времени и, конечно, более или менее четкое представление, зачем и какой стоимости автомобиль нужен. У нас можно взять авто в аренду с водителем так и без водителя. 

Закажите аренду автомобилей в Красноярске у компании «Рента-кар»

Для удобства клиентов аренда автомобилей в Красноярске может быть совершена как на довольно длительный срок – месяц и дольше, так и на сутки. Часто этой услугой пользуются в честь праздничной или знаменательной даты. Взять машину в посуточную аренду от компании Рента-Кар Красноярск – это отличный способ воспользоваться представительным автомобилем на свадьбе, выпускном или на корпоративе.

Lada Niva Travel: внедорожный драйв-тест

Откровенно слабый мотор и достаточно архаичная конструкция. Но… при этом 20 лет в производстве, 700 тысяч проданных авто и верхние строчки в ТОПе продаж среди внедорожников. Всё это Niva Chevrolet. Вернее, так она называлась до прошлого года.

Теперь мы знаем её как LADA Niva Travel. Но поменялось не только имя – изменился и сам автомобиль. Насколько? Что бы разобраться в этом вопросе мы взяли Niva Travel на наш редакционный драйв-тест.

И первое с чего мы начнём знакомство с новинкой — это её изменившаяся внешность. Согласитесь – фейслифт пошёл Ниве Трэвел на пользу. Крупная фальшрадиаторная решётка отлично вписалась в многоуровневую архитектуру передка. Сверху картину довершил большой логотип ладьи. На месте и новые узкие блоки фар головного света производства компании BOSCH. На фоне прежних смотрятся вполне авангардно. Сюда бы ещё светодиодные дневные ходовые огни. Но нет. Обычные. Здесь даже оптика нелинзованная, с привычными рассеивателями. Но, будем справедливы, со своей задачей фары справляются хорошо. Да и стоят дешевле светодиодных.

Идём дальше. Поменяв передок, конструкторы не забыли и крышку капота. Она стала более горизонтальной и обзавелась выраженным рельефом. В стандарте она удерживается в открытом положении штангой, но можно, в качестве допов заказать и газовые упоры.

В полном соответствии с законами автомобильной моды округлые колёсные арки поменялись на прямоугольные и обзавелись обвесом. Его пластиковые элементы окрашены в массе, а потому не боятся сколов и царапин. В версии Off Road обвес чёрного цвета, что очень практично, но в городской версии может быть окрашен и в цвет кузова, как в нашем случае.

Ещё одна характерная деталь новинки, недвусмысленно напоминающая о её внедорожном предназначении – пара буксирных проушин в переднем бампере. Раньше была только одна. Две были сзади. Они там собственно и остались, украсив собою новый бампер. Получилось эффектно. Круче только задние огни. Вот они полностью светодиодные. И устанавливаются на все новые внедорожники Niva Travel независимо от комплектации.

А вот задний парктроник и камера заднего вида с омывателем прерогатива старшей комплектации Luxe. Точно так же, как и обогреваемое по всей площади ветровое стекло и лифт водительского сиденья. А ещё регулировка поясничного упора.

Вообще внутри изменений не так много, как снаружи. И то, большей частью, они появились на дорестайлинговой модели в последний год её производства. Это и мультимедийная голова, и охлаждаемый с помощью кондиционера перчаточный ящик, и подстаканники для пассажиров заднего ряда в водительском подлокотнике. Да,.. появился ещё один потолочный плафон салонного света для пассажиров заднего дивана. Всё остальное оборудование включая систему ЭРА-Глонас хорошо знакомо владельцам Шеви-Нив.

Что же, посмотрим, как всё это будет звучать теперь в едином оркестре. Пора проверить нашего испытуемого дорогой, сегодня, правда, больше напоминающей бездорожье (напомним дело происходило в конце февраля – прим. редакции).

Проверять новую Niva Travel на бездорожье не имело смысла – конструктивно это всё тот же автомобиль со всеми его неоспоримыми достоинствами: постоянным полным приводом, пониженным рядом передач и блокировкой межхколёсного дифференциала. Намного интересней посмотреть, как новая Niva поведёт себя в городе. Не секрет — именно на дорогах общего пользования проходит большая часть жизни поклонников внедорожного «драйвинга». Вот почему мы назвали наш тест невнедорожным.

Первое на что обращаешь внимание — это высокая посадка. Вы сидите над дорогой намного выше многих соседей по дорожному потоку, а значит видите дорожную обстановку намного дальше и, значит можете лучше прогнозировать развитие дорожной ситуации.

Второе – в автомобиле стало заметно тише. Это заслуга улучшенной шумоизоляции. В частности, моторного щита и дверных карт, получивших более толстые звукопоглощающие маты.

Хорошо работает печка. Даже в 20-градусные морозы в салоне Niva Travel можно находится в рубашке, а не кутаться в шубу или куртку. Да и прогревается салон на удивление быстро.

Мультимедийная голова появилась на передней панели ещё в 2019. Она прекрасно справляется со своими обязанностями, становясь то радиоточкой, то экранам навигатора. А ещё сюда можно «отзеркалить» свой смартфон – много ли вы вспомните автомобилей этой ценовой группы с подобным функционалом? Сюда же выводится картинка с камеры заднего вида. Она даже рисует безопасную траекторию. Жаль, что статичную, а не динамику.

Не хватает здесь и мультифункционального руля. Изменять громкость медиа-системы приходится по старинке – ручками на центральной консоли. Не помешал бы и штатный круиз-контроль. Но не будем забывать, что это неизбежно привело бы к удорожанию автомобиля. А ведь цена это один из козырей Niva Travel.

На этом можно было-бы и закончить, но, как не крепились мы всё же не устояли перед соблазном найти в городе хоть какое-то, пусть паркетное, но бездорожье. Не с целью обрести откровение, но что бы ещё раз убедится, что Niva Travel это Внедорожник с большой буквы.

В его активе полноприводная трансмиссия с подключаемым понижающим редуктором и межосевой блокировкой. Дорожный просвет в 220 миллиметров и углы въезда/съезда в 37 и 36 градусов соответственно. Вне зависимости от комплектации все автомобили имеют стальную защиту картера. Глубина преодолеваемого брода с учётом шноркеля в исполнении Off Road – полметра, но, что-то нам подсказывает, что и в стандартном исполнении Niva Travel возьмёт такую глубину. Главное не гнать большую волну.

Что же касается паркетного бездорожья, то с ним наша испытуемая справилась играючи. Так и слышу голоса скептиков: да я здесь и на «классике» проеду! Конечно проедете. А вот через снежный волок на пути к супермаркету можете и не проехать. А Niva Travel проедет. Вот вам ещё один плюс в копилку обновлённой Нивы.

Подведём итоги.

Фейслифт явно пошёл Ниве Трэвел на пользу. Брутальный облик стал больше соответствовать образу этого авто. А такие опции, как полностью обогреваемое ветровое стекло, регулируемое по высоте водительское кресло и камера заднего вида с омывателем максимально облегчают жизнь за рулём.

Но главное это, конечно цена. На старте продаж, в 2002-м, Нива Шевроле стоила 8 000 условных единиц, измеряемых в долларах. Сегодня Niva Travel стоит около 10-ти, по действующему курсу. Минимальный рост за 20-ть лет продаж. Завидное постоянство. Видимо и в этом кроется секрет успеха модели на рынке, позволившей ей оставаться в ТОПе продаж среди внедорожников и разбежаться по дорогам в количестве более 700 000 штук.

Мы благодарим дилерский центр ЛАДА НОРД-АВТО, расположенный в центре Твери, на улице Коробкова, 5 за предоставленный автомобиль и помощь в проведении нашего драйв-теста.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Динамическая настройка FRET в биосенсоре зеленого флуоресцентного белка

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

Кристаллическая структура Twitch-2B

Мы расшифровали структуру с разрешением 2,5 Å (таблица S1A). Асимметричный блок состоит из двух мономеров (рис. S1A). Они представляют идентичные конформации отдельных доменов [среднеквадратичные отклонения (RMSDs) ниже 0,2 Å] и несколько иную междоменную конформацию (RMSD 0,992 Å), но, по-видимому, не собираются как симметричный гомодимер.Их интерфейс (рис. S1B), покрывающий 630 Å 2 ( 11 ), на самом деле значительно меньше, чем интерфейс стабильного димера ( 12 ). Кроме того, данные малоуглового рентгеновского рассеяния (МУРР) показывают, что в растворе Twitch-2B является мономерным (рис. S2). Поэтому мы сфокусируем наше описание здесь на мономере A. Кристаллическая структура показывает расположение донора и акцептора относительно минимального кальций-связывающего домена TnC, а также структуру оптимизированных линкеров (рис.1). Структура кальций-связывающего домена очень похожа на C-концевой глобулярный домен куриного TnC (RMSD 0,84 Å) ( 13 ), на структуру ЯМР, решенную ранее ( 8 ), и на структуру кальмодулина. (RMSD 1,08 Å) ( 14 ). Главные оси двух бочкообразных β-доменов флуоресцентного белка ориентированы почти под перпендикулярным углом друг к другу. Стволы β практически не контактируют друг с другом (рис. 2A) с очень маленькой общей границей раздела (150 Å 2 ).Интерфейсы минимального кальций-связывающего домена с mCerulean3 и cpVenus cd также относительно малы, покрывая только 257 и 351 Å 2 соответственно (см. Ниже). Взаимодействия в основном носят гидрофильный характер (рис. 2А).

Рис. 2 Структурные детали Twitch-2B.

( A ) Полярные взаимодействия между остатками минимального домена TnC, mCerulean3, и cpVenus cd показаны пунктирными линиями. Остатки показаны в виде палочек.( B ) Полярные взаимодействия, опосредованные остатками (показаны в виде стержней) от линкеров между mCerulean3 и кальций-связывающим доменом (у лосося), а также взаимодействия между cpVenus cd и кальций-связывающим доменом (пурпурный) . ( C ) Гидрофобные взаимодействия между остатками (показаны в виде стержней) линкеров между mCerulean3 и кальций-связывающим доменом (у лосося), а также линкером между cpVenus cd и кальций-связывающим доменом (пурпурный) с остатками (серым цветом) из ядра минимального домена TnC.( D и E ) Крупный план области вокруг N532 Twitch-2B и мутанта N532F Twitch-2B (Twitch-6).

Линкер между mCerulean3 и кальций-связывающим доменом (V 232 ADA) образует спираль 3 10 , которая прочно удерживается на месте водородными связями основной цепи от V232 и S236 в mCerulean3 до E301 и E239 кальция. -связывающий домен (рис. 2Б). Далее линкер между кальций-связывающим доменом и cpVenus cd (P 305 IYPEL) образует полтора α-спиральных витка (рис.2, B и C), карбонилы основной цепи E309 и L310 образуют водородные связи с боковой цепью R551 (рис. 2B) cpVenus cd . Боковая цепь E309 также образует водородную связь с Y152 mCerulean3, плотно связывая три домена вместе. Остатки I306, Y307 и L310 этой короткой спирали участвуют в сети гидрофобных контактов (рис. 2C). Очевидно, что скрининг оптимальных линкеров ( 8 ) привел к последовательностям со спиральными элементами, очень хорошо интегрирующимися в структуру минимального домена TnC, в то время как эти линкеры удерживают на месте донорный и акцепторный домены в основном за счет полярных взаимодействий.

Расчет эффективности FRET на основе структуры

Структура предоставила важную информацию для расчетов FRET. Во-первых, расстояние между центрами масс флуорофоров составляет 3,65 нм (рис. 1B). Затем внутри структуры флуорофоры mCerulean3 и cpVenus cd выровнены в конфигурации «голова к голове». Таким образом, мы могли точно определить относительную ориентацию дипольных моментов флуорофоров (рис. 1C; см. Материалы и методы), которые доступны из расчетов теории функционала плотности ( 15 ).Используя эту объединенную информацию, мы вычислили коэффициент ориентации κ 2 , равный 1,98 (уравнение 1; Материалы и методы), и расстояние Ферстера, R 0 , 6,9 нм для mCerulean3 / cpVenus cd . Пара FRET (уравнение 3; материалы и методы). С этими параметрами, используя уравнение Фёрстера, E = R06 / (R06 + r6), теоретическая эффективность FRET, E , Twitch-2B была определена как 0,98. Эффективность FRET, экспериментально определенная с помощью деканшинга донора, равна 0.78 (рис. S3A), что значительно ниже, чем полученное из кристаллической структуры.

Два мономера Twitch-2B в асимметричном блоке (рис. S1A) не только имеют очень похожую конформацию (RMSD основной цепи 0,992 Å), но также образуют очень похожие контакты упаковки кристаллов (рис. S1C). Таким образом, мы заключаем, что ориентация доменов в мономере сама по себе не ограничивается кристаллической упаковкой, а в основном внутримономерными взаимодействиями, описанными выше (рис. 2А), и, скорее всего, выбрана из пула уже существующих конформаций в растворе.Поскольку междоменные интерфейсы в мономере Twitch-2B относительно малы (рис. 2A), высокая гибкость решения может быть причиной наблюдаемого снижения эффективности FRET. Чтобы исследовать эту гипотезу, мы затем обратили внимание на передовые методы ЯМР.

ЯМР-исследование динамики биосенсора

Чтобы получить представление о возможной динамике, мы использовали парамагнитный ЯМР ( 16 ) с образцом Twitch-2B, где два сайта связывания кальция TnC были загружены диспрозием (Dy).Анизотропная магнитная восприимчивость комплекса TnC-Dy 2 индуцирует парамагнитный тензор выравнивания, который может быть определен из структуры ( 17 ) (см. Материалы и методы). Мы использовали спектрометры на 900 МГц и 1,1 ГГц, поскольку тензор юстировки квадратично зависит от магнитного поля. Если данный флуоресцентный белок является жестким по отношению к TnC, то тензор выравнивания, который он испытывает, идентичен TnC. Если, однако, флуоресцентный белок является динамическим по отношению к TnC, то это движение уменьшит тензор выравнивания первого ( 16 , 18 ).Это позволяет количественно оценить динамику флуоресцентных белков по отношению к TnC. В то время как диполярные связи усредняются в изотропном растворе из-за случайного изотропного переворачивания, парамагнитно-индуцированные тензоры выравнивания приводят к анизотропному распределению ориентации TnC и, следовательно, присоединенных зеленых флуоресцентных белков в растворе, что приводит к неполному усреднению диполярного муфты, позволяющие наблюдать остаточные диполярные связи (RDC). Мы определили RDC метильных групп парамагнитно выровненного Twitch-2B ( 19 ) (см. Материалы и методы).Наблюдаемый диапазон RDC достаточен для измерения размера тензора выравнивания ( 20 ), так что отнесение метильных групп не было необходимым.

Мы обнаружили, что диапазон значений RDC и, следовательно, тензор выравнивания, испытываемый флуоресцентными белками, в 10 раз меньше, чем рассчитанные по жесткой рентгеновской структуре (рис. 3; см. Материалы и методы). Таким образом, динамика должна быть причиной несоответствия между расчетной и экспериментальной эффективностями FRET.Кристаллическая структура может быть только частью динамического конформационного ансамбля в растворе.

Рис. 3 Гистограммы парамагнитных данных RDC.

Прогнозирование RDC метильных групп в двух доменах флуоресцентного белка и TnC с использованием рентгеновской структуры (выделено пурпурным цветом). Тензор выравнивания, индуцированный двумя ионами диспрозия, связанными с TnC, является результатом трансляции тензора, полученного из кальмодулина (см. Материалы и методы). Экспериментальные RDC от парамагнитного ЯМР Twitch-2B (зеленый) и Twitch-6 (пурпурный).Дальность действия уменьшается в 10 и 5 раз для Twitch-2B и Twitch-6 соответственно.

Конструирование мутанта на основе структуры с улучшенной эффективностью FRET

Предполагая структурную целостность отдельных доменов, мы предположили, что линкерные области являются стержнем этой динамики. На границах раздела между доменом TnC и донорным и акцепторным доменами преобладают полярные взаимодействия (рис. 2А). Мы предположили, что замена этих взаимодействий гидрофобными контактами сделает линкеры жесткими и увеличит экспериментальную эффективность FRET.С этой целью мы разработали мутацию N532F (рис. 2, D и E) на поверхности cpVenus cd , создавая новое взаимодействие с F249 кальций-связывающего домена (рис. 2D). Как и ожидалось, эта мутация вызвала существенное увеличение максимального изменения отношения FRET с 800 до 1100% in vitro (рис. S4). В кристаллической структуре этого мутанта (Twitch-6; таблица S2) боковая цепь F532 действительно связывается в гидрофобный карман, образованный боковыми цепями F249, Asp262 и Y338 (рис. 2E).В остальном структуры Twitch-6 и Twitch-2B очень похожи (RMSD 0,25 Å), что приводит к почти идентичной теоретической эффективности FRET (см. Дополнительные материалы). Благодаря этой конструкции экспериментальная эффективность FRET Twitch-6 увеличилась до 0,90, с 0,78 для Twitch-2B (рис. S3B), а диапазон RDC, измеренных с Twitch-6, удвоился по сравнению с Twitch-2B (рис. 3). . Это указывает на ужесточение интерфейса между доменом TnC и cpVenus cd , и, таким образом, снижение динамики между доменами является причиной увеличения FRET.

Конформационные ансамбли в решении

Определив динамику как причину снижения эффективности FRET Twitch-2B в решении, мы хотели получить представление о конформационном пространстве, возникающем в результате этой динамики. Для этой цели мы выбрали конформационные ансамбли, исследующие динамику остова исключительно на динамических линкерных областях между доменами флуоресцентного белка и доменом TnC (см. Материалы и методы), оценивая более 1 миллиона шестичленных ансамблей против наблюдаемых RDC и эффективности FRET (Таблица 1, рис.4 и Материалы и методы). Среди всех возможных ансамблей мы выбрали тот, который лучше всего воспроизводит как экспериментальную эффективность FRET, так и диапазон RDC (Таблица 1). Этот ансамбль полностью объясняет, как гибкость неупорядоченных остатков линкерных областей приводит к наблюдаемому снижению эффективности FRET и диапазона RDC.

Таблица 1 Результаты выбора ансамбля. Рис. 4 Ансамбли белков Twitch, согласующиеся с измеренными эффективностями RDC и FRET.

Ансамбли для Twitch-2B (слева) и Twitch-6 (справа) содержат по шесть структур каждый, причем самые большие отклоняющиеся структуры показаны зеленым и красным.Состояния, которые не являются этими крайними конформациями, прозрачны.

Влияние на улучшенную конструкцию датчика FRET

Таким образом, мы получили кристаллическую структуру флуоресцентного кальциевого биосенсора Twitch-2B и вместе с динамикой линкеров, определенной с помощью парамагнитного ЯМР, мы количественно оценили эффективность FRET. Поскольку динамика ограничивала эффективность FRET, мы успешно сконструировали ригидифицированный мутант с увеличенным FRET. Таким образом, структурные и динамические характеристики ратиометрических датчиков FRET обеспечили принципы проектирования, которые могут быть применимы к другим системам, в которых эффекты FRET используются для восприятия сигналов.

МАТЕРИАЛЫ И МЕТОДЫ

Клонирование, экспрессия и очистка Twitch-2B и Twitch-6

Конструкция Twitch-2B была описана ранее ( 8 ). Для настоящего исследования кодирующую последовательность трехдоменного слитого белка клонировали в модифицированный вектор pET16b, кодирующий слитый белок с N-концевой меткой His 7 и расщепляющей последовательностью, распознающей вирус травления табака (TEV). Мутант Twitch-2B N532F (Twitch-6) был создан с использованием набора для сайт-направленного мутагенеза QuikChange (Agilent).Экспрессионные конструкции pET16bTEV-Twitch-2B и pET16bTEV-Twitch-6 трансформировали в штамм Escherichia coli BL21 (DE3). Экспрессию белка проводили при 303 К индукцией 0,5 мМ изопропил-β-d-1-тиогалактопиранозидом. Клетки собирали через 7 часов после индукции. Меченый селенометионином белок Twitch-2B был сверхэкспрессирован в метионин-ауксотрофном штамме E. coli B834 в минимальной среде с добавлением (+) — l-селенометионина в соответствии с группой по экспрессии белка EMBL (Европейская лаборатория молекулярной биологии) (www.embl.de).

Осадок клеток из 1 литра встряхиваемой культуры ресуспендировали в 60 мл лизирующего буфера [20 мМ трис-HCl (pH 7,9), 300 мМ NaCl, 20 мМ имидазол, 0,5 мМ фенилметилсульфонилфторид с одной таблеткой полного количества ЭДТА- свободных ингибиторов (Roche) на 100 мл лизисного буфера]. Клетки лизировали ультразвуком с последующим центрифугированием при 27000 g, и 277 К. Из супернатанта рекомбинантный белок очищали с помощью аффинной хроматографии с иммобилизованным металлом на 3 мл агарозной смолы Ni-нитрилотриуксусной кислоты (NTA) (Qiagen).Метку слияния His 7 отщепляли протеазой TEV и удаляли инкубацией с 1 мл Ni-NTA агарозной смолы. Белок диализовали против 20 мМ трис (pH 7,0) и 150 мМ NaCl. После доведения концентрации сульфата аммония в растворе белка до 1 М белок дополнительно очищали с помощью хроматографии гидрофобного взаимодействия на колонке с фенилсефарозой (GE Healthcare) объемом 10 мл. Белок элюировали с этой колонки 50-мл градиентом от 1 до 0 М сульфата аммония.Фракции, содержащие белок, объединяли и концентрировали до объема 2,5 мл с помощью концентратора для ультрафильтрации с MWCO (пороговая молекулярная масса) 30 кДа (Vivascience). Наконец, белок очищали эксклюзионной хроматографией на гель-фильтрационной колонке HiLoad 26/60 Superdex 200 мкг. Фракции пика объединяли, диализовали против 20 мМ трис-HCl (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 , и концентрацию белка доводили до 20 мг / мл.

Флуоресцентная спектроскопия

Для спектроскопии рекомбинантного Twitch-2B in vitro белок был очищен от E.coli с использованием смолы Ni-NTA, как описано ( 6 ). Спектроскопию выполняли на спектрофотометре Cary Eclipse (Varian). Донорское расщепление Twitch-2B проводили путем расщепления Twitch-2B в связанном с кальцием состоянии в течение ночи при комнатной температуре с химотрипсином (70 Ед / мл; Sigma-Aldrich) при записи FRET. Небольшое оставшееся излучение cpVenus cd после переваривания химотрипсина было избирательно фотообесцвечено (5 мин) с помощью матрицы из шести светодиодов Luxeon Lumiled с пиком на длине волны 530 нм, для общей рассеиваемой мощности 14.7 Вт и 870 люмен. Для защиты mCerulean3 от обесцвечивания использовали LP (длиннопроходный) фильтр с длиной волны 500 нм. Связанный с кальцием Twitch-6 был очень устойчив к расщеплению протеазой. Поэтому EGTA (конечная концентрация 5 мМ) добавляли во время переваривания химотрипсина, чтобы получить спектр деквенированного mCerulean3.

Кристаллизация, сбор данных и определение структуры

Кристаллы Twitch-2B и Twitch-6 были получены путем диффузионного смешивания паров 1 мкл раствора белка с 1 мкл раствора для лунок [0.2 M Na-формиат (pH 7,0), 5 мМ CaCl 2 и 18-20% полиэтиленгликоля 3350]. Кристаллы были подвергнуты криозащите, перенеся их в лунку с добавлением 16-18% глицерина на 1 мин и быстро охладив, погрузив в жидкий азот.

Сбор данных производился в PXII, SLS, Швейцария, с использованием детектора PILATUS 6M (Dectris). Собственные данные собирали при 100 К на длине волны 1 Å. Данные по производному селенометионина были измерены при 0,98 Å. Все данные были обработаны с помощью программного обеспечения рентгеновского детектора (XDS) ( 21 ) и масштабированы с помощью SADABS (Bruker AXS).Определение пространственной группы и статистический анализ выполняли с использованием XPREP (Bruker AXS). Фазирование выполняли с помощью AutoSol ( 22 ).

Первоначальная модель была построена с помощью AutoBuild и дважды уточнена с помощью phenix.refine ( 23 ) с промежуточным ручным построением модели с помощью Coot ( 24 ). Окончательная модель была получена путем комбинированного ручного отслеживания (Coot) и уточнения с использованием Refmac5 ( 25 ). На графике Рамачандрана 96,69% ​​остатков располагались в предпочтительной области 2.72% в разрешенной области и 0,58% остатков были выбросами. Кристаллическая структура Twitch-6 была решена с помощью PHASER ( 26 ), используя PDB (Protein Data Bank) запись 6GEL в качестве модели поиска. Построение и уточнение модели выполнялись, как описано для Twitch-2B. Для этого мутанта 96,68% остатков попали в предпочтительную область графика Рамачандрана, 2,83% попали в разрешенную область и 0,49% были выбросами.

Расчеты FRET

Фактор ориентации, κ 2 , может быть извлечен из структурной информации следующим образом: κ2 = (cos θT — 3 cos θD cos θA) 2 (1) где θ T — угол между эмиссионным переходом диполь донора и диполь перехода поглощения акцептора; θ D и θ A — углы между этими диполями и вектором r , соединяющим донорный и акцепторный флуорофоры ( 27 ).Ориентация дипольных моментов перехода относительно вектора связи C O (ω) в градусах ωD = 73 ° ωA = 76 ° была взята из Ansbacher et al. ( 15 ), а угловые параметры были извлечены из кристаллографических координат в угловых единицах θT = 152,95 ° θD = 149,17 ° θA = 26,79 °

Подробные расчеты поясняются в файле данных S1. Интеграл перекрытия, Дж (λ), был рассчитан из экспериментальных спектров поглощения и излучения изолированных доменов cpVenus и mCerulean3 соответственно (рис.S5) со сценарием Python, включенным в качестве дополнительной информации. J (λ) было определено как 2,052 × 10 15 M −1 см −1 нм 4 , как следует: J (λ) = ∫0∞FD (λ) εA (λ) λ4dλ = ∫0∞FD (λ) εA (λ) λ4dλ∫0∞FD (λ) dλ (2) где F D (λ) — нормированная интенсивность флуоресценции донора в диапазоне длин волн от λ до λ + Δλ. ε A (λ) — коэффициент экстинкции акцептора при λ.

Расстояние Ферстера, R 0 , можно рассчитать на основе ранее полученных экспериментальных параметров R0 = 0.211 (κ2n − 4QDJ (λ)) 1/6 (3) где Q D (0,87) — квантовый выход донора в отсутствие акцептора ( 4 ) и n , (1,33) показатель преломления водной среды.

Наконец, эффективность передачи энергии, E , может быть рассчитана как отношение скорости передачи к общей скорости распада донора в присутствии акцептора E = R06R06 + r6 (4)

После этой процедуры, эффективность FRET была определена как E = 0.979, из кристаллографической структуры Twitch-2B. Эквивалентный расчет, выполненный со структурой мутанта Twitch-6, дает E = 0,983 (см. Файлы данных S1 и S2).

ЯМР-спектроскопия

Мы экспрессировали белки Twitch-2B и Twitch-6 в минимальной среде Toronto, приготовленной из 100% D 2 O и пердейтерированной d-глюкозы и дополненной предшественниками аминокислот α-кетомасляной кислотой (метил-13C , 3,3-D2) и α-кетоизовалериановой кислоты (3-метил-13C, 3,4,4,4-D4), таким образом, селективно мечение атомами 13 C и 1 H только метильных групп остатки валина, лейцина и изолейцина, сохраняя при этом остальные атомы C как 12 C и протоны как 2 H ( 19 ).

Сначала изотропные спектры образцов получали в буфере А [20 мМ Mops (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 в 100% D 2 O]. Затем белки диализовали против буфера B [20 мМ Mops (pH 7,0), 100 мМ NaCl и 10 мМ EDTA] с последующим диализом против буфера C [20 мМ Mops (pH 7,0) и 100 мМ NaCl] и, наконец, заменяли на буфер С, приготовленный в 100% D 2 O, содержащем три эквивалента диспрозия, перед измерениями ЯМР. Концентрация белка в образцах была примерно 0.5 мМ.

Образцы были протестированы с помощью экспериментов с метил-TROSY ( 19 , 28 ) (рис. S7) на частотах 900 МГц и 1,1 ГГц, а связи J и J + RDC были определены с использованием J -модулированного Эксперимент с метил-TROSY ( 29 ), изображенный на рис. S6 в виде матриц 2048 × 128 комплексных точек данных с 96 переходными процессами на приращение ( t 1 ). Общие использованные задержки модуляции J были следующими: 4, 6, 8, 10, 12, 14, 16, 18 и 20 мс (рис.S8). ЯМР-эксперименты проводились с использованием 5-мм TCI (криозонда тройного резонанса с инверсным детектированием) на спектрометре 900 МГц и 3-мм криозонда TCI на спектрометре 1,1 ГГц, оба оснащены консолями NEO (Bruker). Интенсивности (максимальная амплитуда) сигналов были извлечены с помощью CARA (компьютерное определение резонанса) ( 30 ) в экспериментах с обработкой NMRPipe ( 31 ) и проанализированы с помощью скриптов Python (рис. S8) в соответствии с Pederson et al. ( 29 ).

Расчет парамагнитного тензора

Мы взяли парамагнитный тензор из комплекса кальмодулин-IQ, связанного с диспрозием, из ( 18 ) и рассчитали полный тензор дважды занятого кальцийсвязывающего домена TnC. Сайт связывания кальция 1 TnC перекрывается с сайтом связывания лантанидов кальмодулина (CaM N60D). Мы повернули матрицу выравнивания с сайта связывания кальция из CaM на второй сайт связывания кальция TnC и добавили его к тензору сайта связывания кальция 1, таким образом получив общий тензор TnC.Затем этот тензор использовался для расчета RDC из парамагнитных белков Twitch ACaM = (1,05 10−31−1,92 10−322,04 10−31−1,92 10−32−1,22 10−316,46 10−322,04 10−316,46 10−321,67 10−32 ) ATwitch = (1,46 10-318,39 10-323,46 10-318,39 10-32-1,06 10-312,26 10-323,46 10-312,26 10-32-3,92 10-32)

Тензоры даны в м 3 M −1 .

Генерация ансамбля

Сначала мы индивидуально смоделировали все возможные двугранные углы основной цепи (ϕ и ψ; выборка с шагом 60 °) линкерных остатков (от Arg 229 до Gln 231 для mCerulean3 и Met 311 до Gly 313 для cpVenus), что не привело к стерическому конфликту между одним из модифицированных доменов флуоресцентного белка и доменом TnC.Каждую из двух линкерных областей моделировали независимо. Из всех возможных комбинаций ϕ, ψ (117 649) вращение mCerulean3 привело к 477 возможным конформациям, в то время как cpVenus допустил 84 конформации, обеспечивая в целом 40 086 возможных конформаций.

Во-вторых, мы случайным образом объединили возможные структуры для mCerulean-TnC и TnC-cpVenus в ансамбли из шести членов. Мы произвольно отобрали 1 миллион шестичленных ансамблей из 40 068 возможных ϕ, ψ-комбинаций линкеров между mCerulean и TnC и между TnC и cpVenus, чтобы гарантировать правильное исследование конформационного пространства Twitch.

В-третьих, мы рассчитали диапазон RDC (используя тензор, полученный, как описано выше) и FRET ансамблей и сравнили их с экспериментальными значениями, определив коэффициент качества ансамбля Qens = ∑i = 1i = 6 (RDCi − RDCeRDCe) 2+ (FRETi − FRETeFRETe) 2, где RDC i — диапазоны распределения, субиндекс e указывает экспериментальное значение, а i указывает значение из члена ансамбля. Такое значение добротности отличается от 0, если совпадения предсказанных откликов RDC и FRET от ансамбля отклоняются от экспериментальных данных, и 0 в случае полного совпадения.Наконец, ансамбли были отсортированы по их Q и , и был выбран самый низкий из них.

Измерения SAXS

Данные SAXS были собраны на линии пучка BM29 Европейского центра синхротронного излучения (ESRF) в Гренобле, Франция, с использованием автоматического устройства смены образцов ( 32 ). Белок диализовали либо против буфера A [20 мМ Mops (pH 7,0), 100 мМ NaCl и 5 мМ CaCl 2 ] (связанное с кальцием состояние), либо против буфера B [20 мМ Mops (pH 7,0), 100 мМ NaCl и 10 мМ ЭДТА] (без кальция).Перед измерением белок центрифугировали для удаления более крупных частиц. Образцы измеряли при концентрациях 2,5, 10 и 20 мг / мл. Буфер для диализа использовали для коррекции эталонного буфера. Данные собирали при 293 К с использованием длины волны 0,995 Å и расстояния от образца до детектора 2,867 м. Загружали сто микролитров каждой концентрации образца, собирали и объединяли 10 кадров. Образцы постоянно подавались в кювету, чтобы минимизировать эффекты радиационного повреждения.Изображения детектора были объединены и преобразованы в одномерные кривые рассеяния, а вклады буфера в рассеяние были вычтены с использованием программного обеспечения BsxCuBE. Дальнейшая обработка данных выполнялась автоматически с использованием онлайн-конвейера EDNA ( 33 ) для оценки качества образца и эффектов радиационного повреждения. Агрегации белков или радиационного повреждения не наблюдалось.

Данные были дополнительно проанализированы с помощью программного пакета ATSAS ( 34 ). Вкратце, первичная обработка и анализ данных проводились с использованием программ PRIMUS ( 35 ) и GNOM ( 36 ).

Теоретическое рассеяние от кристаллической структуры было рассчитано с использованием программы CRYSOL ( 37 ) (рис. S2), а молекулярные массы рассчитаны с использованием образца бычьего сывороточного альбумина в качестве стандарта.

Благодарности: Мы благодарим персонал компании SLS, X10SA за поддержку при сборе рентгеновских данных и ESRF, BM29 за поддержку при сборе данных SAXS. Мы благодарим M. Paulat, C. Schwiegk и A. Moritz за техническую помощь в производстве белка и K.Оверкамп для масс-спектров электроспрея. С. благодарит T. Gruene и G. Sheldrick за советы по уточнению кристаллической структуры и структурному анализу. К.Г. и П.Т.-М. поблагодарить R. Kuemmerle (Bruker Biospin) за измерения ЯМР на частоте 1,1 ГГц. Финансирование: Эта работа была поддержана Обществом Макса Планка и DFG SFB 870 (O.G.). П.Т.-М. был поддержан докторской стипендией Гумбольдта. Вклад авторов: P.T.-M. выполнен ЯМР. П.Т.-М. и К.Г. разработал парамагнитный метод ЯМР.П.Т.-М. рассчитаны структурные ансамбли. П.Т.-М. и С. выполнены измерения SAXS. К.Г. рассчитал FRET по рентгеновским структурам. T.T. и O.G. определили экспериментальные эффективности FRET. С. кристаллизовал Twitch-2B и Twitch-6 и решил кристаллические структуры. Рукопись написана всеми авторами. С. разработал проект. Конкурирующие интересы: Авторы заявляют, что у них нет конкурирующих интересов. Доступность данных и материалов: Структуры депонированы с кодом 6GEL для биосенсора Twitch-2B и 6GEZ для мутанта Twitch-2B N532F (Twitch-6).Все данные, необходимые для оценки выводов в статье, представлены в документе и / или дополнительных материалах. Дополнительные данные, относящиеся к этой статье, могут быть запрошены у авторов.

Обычно используемые флуорофоры FRET способствуют коллапсу неупорядоченного белка

Значимость

Белки принимают неупорядоченные ансамбли до сворачивания, а иногда и как часть своей функции. Моделирование и исследования FRET часто описывают неупорядоченные конформации как более компактные, чем состояния случайных клубков, наблюдаемые при высоком денатуранте, тогда как малоугловое рассеяние рентгеновских лучей (SAXS) указывает, что эти конформации остаются расширенными.Устранение этого несоответствия улучшает наше понимание свойств белков, например, является ли вода достаточно плохим растворителем, чтобы вызвать неспецифический коллапс. Мы достигаем согласования, показывая, что добавление флуорофоров FRET уменьшает размеры неупорядоченного белка. Подробный анализ FRET и SAXS, наряду с учетом сокращения, индуцированного флуорофором, демонстрирует, что неупорядоченные и развернутые белки часто остаются сольватированными и расширенными без денатуранта, свойства, которые минимизируют неправильную укладку и агрегацию.

Abstract

Размеры, которые развернутые белки, включая внутренне неупорядоченные белки (IDP), принимают в отсутствие денатуранта, остаются спорными. Мы разработали процедуру анализа профилей малоуглового рассеяния рентгеновских лучей (SAXS) и использовали ее, чтобы продемонстрировать, что даже относительно гидрофобные IDP остаются почти такими же расширенными в воде, как и при высоких концентрациях денатуранта. Напротив, как показано здесь, большинство измерений резонансного переноса энергии флуоресценции (FRET) показали, что относительно гидрофобные IDP значительно сокращаются в отсутствие денатуранта.Мы используем два независимых подхода для дальнейшего изучения этого противоречия. Во-первых, с помощью SAXS мы показываем, что флуорофоры, используемые в FRET, могут вносить вклад в наблюдаемое расхождение. В частности, мы обнаружили, что добавление Alexa-488 к нормально расширенному IDP вызывает сокращение еще на 15%, что вполне соответствует сокращению, о котором сообщалось в исследованиях на основе FRET. Во-вторых, используя нашу процедуру моделирования и анализа для точного извлечения радиуса инерции (R g ) и расстояния от конца до конца (R ee ) из профилей SAXS, мы проверили недавнее предположение, что результаты FRET и SAXS могут быть согласованным, если R g и R ee «разъединены» (т.е.е., больше не просто пропорциональны), в отличие от случая гомополимеров случайного блуждания. Однако мы обнаружили, что даже для развернутых белков эти две меры измерений развернутого состояния остаются пропорциональными. Вместе эти результаты предполагают, что улучшенные процедуры анализа и коррекция значительных взаимодействий, управляемых флуорофором, достаточны для согласования предыдущих исследований SAXS и FRET, обеспечивая тем самым единую картину природы развернутых полипептидных цепей в отсутствие денатурирующего агента.

Белковые нарушения являются важным компонентом разнообразных клеточных процессов (1-4). В отличие от хорошо свернутых белков, которые населяют четко определенное функциональное состояние, развернутые и внутренне неупорядоченные белки (IDP) образуют широкий набор быстро взаимопревращающихся конформаций (3⇓⇓⇓⇓ – 8) с ошибками, которые плохо изучены и трудно измерить. . Особый интерес представляет степень, в которой ВПЛ заключают контракты в физиологических условиях (т. Е. В отсутствие денатурирующих агентов). Такое сокращение может иметь широкие последствия для нашего понимания сворачивания белков, взаимодействий и стабильности, а также действия денатурирующих веществ.Более того, понимание степени сжатия неупорядоченных ансамблей имеет огромное значение для разработки реалистичных симуляций складчатости и интерпретации измерений малоуглового рентгеновского рассеяния (SAXS) и FRET (9, 10).

Наше понимание физико-химических принципов, лежащих в основе того, будет ли полипептидная цепь складываться, принимать неупорядоченный, но, тем не менее, относительно компактный ансамбль или вести себя как расширенное, полностью сольватированное, самоизбегающее случайное блуждание (SARW), недостаточно для объяснения существующих данных.Большая часть этого понимания получена из исследований белков, разворачиваемых высокими концентрациями денатурирующих веществ, таких как мочевина и гидрохлорид гуанидина (Gdn). В этих условиях консенсус состоит в том, что белки ведут себя как SARW с показателем Флори (ν) 0,60 в соотношении R g ∝ N ν (N = длина цепи). Напротив, нет единого мнения относительно поведения ВПЛ при более низком уровне денатуранта или его отсутствии. В частности, в то время как многочисленные FRET (11⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓⇓ – 25) и вычислительные исследования (11, 14, 18, 23, 26⇓⇓ – 29) утверждали, что расширенный неупорядоченный ансамбль обнаруживает при высоком уровне денатуранта сжимается значительно [обычно на 25–50% при переходе на низкий денатурант или без него (ν <0.5)] (11, 14, 18, 23, 26⇓ – 28, 30⇓⇓⇓⇓ – 35), аналогичное количество исследований SAXS сообщает о небольшом сокращении или его отсутствии в тех же условиях (10, 36–35). 41).

Разнообразные недавние исследования пытались примирить это несоответствие (Fig. 1 A ), которое имеет глубокие последствия для физики сворачивания белков. Применение более реалистичных симуляций и аналитических моделей привело к тому, что расстояния, полученные с помощью FRET, имеют меньшую денатурантную зависимость (Рис. 1 A , Bottom ) (40, 42⇓ – 44).Параллельно улучшены данные и анализ SAXS, включая использование безразмерного графика Кратки, чтобы подчеркнуть изменения ν, а не R г (что важно, поскольку добавление флуорофоров на концах цепи увеличит R г из-за их массы), также предоставили доказательства незначительного сжатия ниже 2 M Gdn (рис. 1 A , Bottom ) (45, 46). Тем не менее, значительные расхождения сохраняются в отсутствие денатуранта, даже когда для анализа одного и того же белка в идентичных условиях используются одни и те же подходы (рис.1, SI Приложение , рис. S1 и S2 и Movie S1). Недавние исследования показали, что это несоответствие может быть устранено с помощью целостного анализа (42, 43), подчеркивая разделение между обычно фиксированной, пропорциональной зависимостью между R g (определено из измерений SAXS) и R ee (определено из Измерения FRET) без необходимости вызывать возмущение из-за присутствия флуорофоров (42).

Рис. 1.

Улучшенные процедуры анализа не устраняют расхождения между измерениями IDP, полученными с помощью SAXS и FRET.( A ) Данные R17 SAXS и FRET (из ссылки 43). ( A , Top ) Сравнение результатов, полученных при подборе данных FRET в предположении гауссовой цепи и данных SAXS с использованием приближения Гинье. ( A , Bottom ) Данные SAXS и FRET подходят с использованием нашего метода анализа MFF и аналогичного подхода (45). Черная линия лучше всего подходит гиперболической линии тренда; серые линии — 95% доверительные интервалы. ( B ) Профили SAXS для R17 ( Left , данные из Ref.43) и N98 (, правый , данные из ссылки 42), согласованные с MFF, значительно отличаются от ожидаемого поведения с использованием значений ν, взятых из аналогичного анализа данных FRET. Сплошные линии обозначают область, используемую в процедуре подбора; пунктирные линии представляют экстраполяцию к более высоким значениям q. Хотя подходило ~ 500 точек на кривую рассеяния (серый цвет), большинство показанных данных были объединены только для целей презентации (черные точки). Повороты или перегибы данных при более высоких значениях qR g , скорее всего, связаны с ошибками при вычитании буфера, что является более сложным при высоком q, низкой концентрации образца и / или сниженном контрасте рассеяния (например.g., при высоком денатуранте, см. Материалы и методы ). ( C ) Тенденции гидрофобности (Кайт-Дулиттл) в зависимости от ν в отсутствие денатуранта, полученного из SAXS, путем применения MFF к опубликованным данным, собранным из последовательностей складываемых белков (42, 45, 67⇓⇓⇓⇓⇓⇓⇓⇓⇓ № – 82). Также показаны результаты исследований FRET, рассчитанные как в исх. 20 для опубликованных данных (20, 42). Красная линия тренда для данных FRET из исх. 20. Черная линия тренда лучше всего соответствует показанным результатам SAXS. ( C , Top ) Гистограмма гидрофобности репрезентативных белков в PDB (набор данных из исх.45). ( D ) Кумулятивные распределения ν для репрезентативных белков из PDB, выведенные из линий тренда, показанных в C .

Чтобы всесторонне сравнить результаты исследований SAXS и FRET, мы собрали опубликованные наборы данных для различных ВПЛ (Рис. 1 C и D и SI Приложение , Таблица S3). При анализе с использованием нашего моделирования и молекулярного форм-фактора (MFF) исследования SAXS неизменно находят ν> 0,53 (среднее = 0,55), тогда как ν, полученное из исследований FRET, обычно падает ниже 0.50 (среднее значение = 0,46). Это расхождение 0,09 является существенным по отношению ко всему диапазону ν, который варьируется только от 0,6 (для SARW) до 0,5 (где внутрицепочечные взаимодействия одинаково благоприятны для взаимодействий растворитель-цепь) до 0,33 (для уплотнения в сферу; это несколько выше для несферических компактных состояний). В целом результаты SAXS предполагают, что конформационные ансамбли большинства развернутых белков и IDP с белковоподобным составом последовательностей сильно расширены (ν> 0.5) и вода является хорошим растворителем, тогда как FRET предполагает иное (рис. 1 D ).

Приведенные выше и другие результаты привели нас и других к поиску факторов, которые могут способствовать постоянному несоответствию между представлениями измерений IDP на основе SAXS и FRET (9, 29, 39, 42, 43, 47⇓⇓ – 50 ). Одна альтернатива, обозначенная здесь «гипотеза разделения гетерополимера», утверждает, что гетерополимерная природа белков приводит к изменению взаимосвязи между R g и R ee , взаимосвязь, которая является фиксированной (т.е.е., независимо от длины цепи) в соотношении 6,3 для гомополимера SARW. Недавнее моделирование показывает, что это соотношение не может быть зафиксировано для развернутых белков, которые более сложны, чем гомополимеры (29, 39, 42, 43). Эта «развязка» предлагает возможное объяснение несоответствия между SAXS (который чувствителен к R g ) и FRET (который чувствителен к R ee ). Напротив, вторая гипотеза, обозначенная здесь «гипотеза взаимодействия флуорофора», предполагает, что в отсутствие денатуранта флуорофоры FRET взаимодействуют друг с другом и / или с полипептидной цепью, вызывая конформационный ансамбль конструкций, модифицированных флуорофором, к сокращаются больше, чем в отсутствие этих флуорофоров (9, 45, 47, 50, 51).

Здесь мы обращаемся как к гипотезе разделения, так и к гипотезе взаимодействия флуорофора. Мы использовали SAXS, чтобы охарактеризовать радиус вращения IDP до и после добавления обычно используемого флуорофора. Мы обнаружили, что такая модификация флуорофора изменяет конформационный ансамбль в отсутствие денатуранта, уменьшая его размеры, измеренные методом SAXS, на 10–20%. В сочетании с улучшенными процедурами анализа с использованием реалистичных смоделированных ансамблей как для SAXS, так и для FRET, этого индуцированного флуорофором коллапса достаточно для согласования результатов исследований SAXS и FRET.Параллельно с этим мы представляем измерения SAXS на полиэтиленгликоле (PEG), подтверждающие предыдущие сообщения о том, что добавление флуорофоров также вызывает сокращение этого, в противном случае, полимера SARW (9), открытие, которое недавно было подвергнуто сомнению (42). Кроме того, мы показываем, что SAXS может извлекать R g , ν и R ee с точностью выше 97% при анализе с использованием нового MFF, разработанного для гетерополимеров. Эти симуляции достаточно точны для воспроизведения данных рассеяния без необходимости выбора только подансамбля конформаций, как это обычно используется в других процедурах подбора данных.Наконец, мы демонстрируем степень, в которой можно использовать небольшие отклонения от идеальности в данных SAXS, чтобы сделать вывод о смещениях внутри гетерополимерного конформационного ансамбля.

Результаты

Флуорофорная маркировка вызывает коллапс.

Чтобы напрямую проверить гипотезу взаимодействия флуорофора, мы измерили профили SAXS немодифицированного IDP и того же самого IDP, сайт-специфически модифицированного одной или двумя копиями широко используемого флуорофора FRET Alexa-488. Мы выбрали этот флуорофор, потому что он относительно небольшой и гидрофильный, что снижает вероятность образования взаимодействий, которые могут изменить развернутый ансамбль, по сравнению с большинством других флуорофоров FRET (43).В качестве тестового белка мы использовали PNt, IDP с хорошим поведением, содержащий 334 аминоконцевых остатка пертактина (52). Для получения PNt, модифицированного моно- и двойным флуорофором, мы использовали тиол-реактивный Alexa-488 для модификации остатков цистеина в положении 117 (PNtC-Alexa488) или положениях 29 и 117 (PNtCC-Alexa488). В качестве контроля мы использовали немодифицированный родительский белок (PNt) и алкилирование для получения конструкций без флуорофоров (PNtC-Alkd и PNtCC-Alkd).

Добавление Alexa-488 снижает размеры PNt, измеренные методом SAXS, как в отсутствие Gdm, так и при промежуточных концентрациях (рис.2 A и SI Приложение , таблица S1). В частности, при переходе от 4 к 0 M Gdn, R g и ν уменьшаются почти вдвое больше для модифицированного флуорофором PNtCC-Alexa488, чем для PNtCC-Alkd или PNt (рис.2 B и SI Приложение ). , Таблица S1). Эти данные указывают на то, что присутствие Alexa-488 приводит к сокращению конформационного ансамбля PNt. Следует отметить, что в то время как 2 M Gdn является хорошим растворителем (ν> 0,50) для немеченого белка, мечение флуорофором приводит к измеримым внутримолекулярным взаимодействиям даже при этой относительно высокой концентрации денатуранта (рис.2 B , Правый ). В соответствии с общим происхождением эффекта, величина этого зависящего от денатуранта расширения качественно аналогична наблюдаемой FRET для множества других белков (Fig. 1 B ) (42, 43). Мы также наблюдали зависимое от флуорофора уменьшение среднего R g и ν для конструкции с одной меткой PNtC-Alexa488 (рис. 2), что указывает на то, что, помимо предполагаемых взаимодействий флуорофор-флуорофор, взаимодействия флуорофор-белок также вносят вклад в наблюдаемое сокращение.

Рис. 2.

Добавление Alexa-488 изменяет разброс PNt. ( A ) Безразмерные графики Кратки для PNt дикого типа (серый), PNtCC-алкилированного (черный), PNtC-Alexa488 (одиночная метка, синий) и PNtCC-Alexa488 (двойная метка, красный) в 0,15 M KCl, 2 M Gdn и 4 M Gdn. Планки погрешностей представляют собой распространенную ошибку из SD, рассчитанного с учетом статистики подсчета (Пуассона), где σ = √counts. Данные были подогнаны и отображены в соответствии с процедурой, описанной на рис. 1 (см. Также Материалы и методы ).Результаты для алкилированного PNt неотличимы от PNt дикого типа, но есть значительные различия для PNt, меченного флуорофором Alexa-488. ( B ) R g и ν как функция концентрации Gdn. Данные серых кривых из исх. 45.

Следует отметить, что это сокращение происходит, несмотря на установившиеся значения анизотропии флуоресценции для PNtCC-Alexa488, равные 0,11 и 0,08 в 0 и 2 М денатуранте, соответственно ( SI Приложение , Таблица S2), ниже порогового значения, которое обычно рассматривается в качестве доказательства. свободного вращения прикрепленных к белкам флуорофоров (42, 53).Из этих результатов мы заключаем, что добавление даже одного из более мелких, более гидрофильных флуорофоров, обычно используемых для измерений FRET, может значительно уменьшить размеры неупорядоченной полипептидной цепи (42, 43, 53), наблюдение, которое помогает согласовать SAXS – FRET несоответствие.

Размеры ПЭГ, полученные методом SAXS, не зависят от концентрации полимера.

В более раннем исследовании мы сообщили, что добавление Alexa-488/594 к PEG приводило к денатурант-зависимому изменению FRET (9), аналогичному тому, которое наблюдается в развернутых белках.Однако сжатия не наблюдалось, когда эквивалентный немеченый полимер исследовали с помощью малоуглового рассеяния нейтронов. Было высказано предположение, что высокие (3 мМ) концентрации ПЭГ, использованные в этом исследовании рассеяния, маскируют то, что в противном случае было бы зависимым от денатуранта изменением в R g (42). Чтобы проверить это, мы измерили профили SAXS в диапазоне концентраций ПЭГ и денатуранта и не обнаружили никаких доказательств значительного изменения размеров этого высокогидрофильного полимера (рис.3). Аналогичным образом, во всех условиях мы наблюдали показатель Флори, равный 0,60, что дополнительно подтверждает, что ПЭГ ведет себя как SARW независимо от концентрации денатуранта. Эффекты флуорофора, а не сокращение цепи, таким образом, остаются простейшей интерпретацией денатурант-зависимых изменений FRET, ранее наблюдавшихся для меченных флуорофором вариантов этого полимера (9).

Рис. 3. Профили

SAXS ПЭГ не зависят от денатуранта. ( A ) Безразмерные графики Кратки для ПЭГ 24 кДа при 0.5 мМ и 0,05 мМ в 0,15 M KCl, 2 M Gdn и 4 M Gdn. Нормализованный профиль рассеяния PEG 24 кДа не изменяется от 0 до 4 M Gdn в широком диапазоне концентраций PEG. Для ясности профили рассеяния смещены по вертикали. Данные были подогнаны и отображены с использованием процедуры, описанной на фиг. 1. ( B ) R g и ν как функции концентрации Gdn для 0,5 мМ и 0,05 мМ PEG. Открытые и закрытые точки смещены по горизонтали для ясности.

Проверка гипотезы о разделении гетерополимеров.

Взятые вместе, вышеупомянутые наблюдения показывают, что флуорофоры, добавленные к IDP, приводят к значительному сокращению, что способствует различным выводам, сделанным из предыдущих исследований SAXS и FRET. Эти наблюдения, однако, не исключают возможность того, что, как утверждалось ранее (42), развязка гетерополимера (т. Е. Соотношение между R ee и R g , отклоняющееся от фиксированной пропорциональности, наблюдаемой для гомополимеров) также может вносить свой вклад. к расхождению SAXS – FRET.

Чтобы исследовать, приводит ли конформационный ансамбль реалистичного гетерополимера к значительной непропорциональности между R ee и R g , мы использовали Upside, наши модели Cβ-уровня (54, 55), чтобы смоделировать рассеяние для развернутых ансамблей. 50 белков из 250–650 остатков, случайно выбранных из банка данных по белкам (PDB). В своей простейшей версии Upside представляет собой каркас полипептида с шестью атомами на остаток (N, Cα, C, H, O и Cβ) и использует зависимые от соседей карты Рамачандрана, полученные из библиотеки катушек (56).Такие модели способны воспроизводить R g и NH остаточные диполярные связи (RDC), наблюдаемые в развернутых белках; эти два параметра чувствительны к глобальным и локальным свойствам магистрали соответственно (57, 58). Для создания ансамблей гетерополимеров мы отнесли каждый Cβ либо к гидрофобному, либо к полярному (H / P). Благоприятные профили взаимодействия (форма, показанная в ссылке 45, SI, приложение , рис. S3 A ) вводятся только между атомами Cβ гидрофобных остатков, а самопереключение накладывается на все атомы.Для каждой из 50 последовательностей мы использовали 30 различных сил взаимодействия Cβ. После создания этих 1500 ансамблей H / P конформаций скелета мы добавили явные боковые цепи (59), а затем рассчитали профили рассеяния гидратированных версий белков (60).

Для этих 1500 ансамблей мы сравнили истинные значения R g , ν и R ee , рассчитанные непосредственно из атомных координат, со значениями, полученными путем аппроксимации моделированного рассеяния (с добавлением реалистичных случайных ошибок) с использованием нашей оригинальной MFF, разработанной для гомополимеров (45).Как и в случае гомополимеров, мы находим, что значения R ee и R g , наблюдаемые в этих моделированиях, пропорциональны (т. Е. Остаются связанными) с коэффициентом корреляции R 2 = 0,99 (рис. 4 А ). Затем мы аппроксимируем смоделированные профили рассеяния, чтобы определить: R g соответствует , ν соответствует и R ee соответствует , причем последнее получено с использованием соотношения (R ee / R g ) 2 = G (ν), где G (ν) была откалибрована с использованием нашего исходного моделирования гомополимеров ( SI Приложение , рис.S1 D ). Мы обнаружили среднее абсолютное отклонение всего 1,3 Å, 0,011 и 4,2 Å соответственно, что представляет собой среднюю абсолютную ошибку 3%, 2% и 4% для R g , ν и R ee ( SI Приложение , рис. S3). Наибольшие отклонения наблюдаются для более компактных конструкций; для более протяженных конформаций (ν> 0,54) ошибка составляет ∼2%. Корреляция R g соответствует и R ee соответствует осталась высокой, R 2 > 0.99.

Рис. 4.

Моделирование обнаруживает сильную связь между R g и R ee , а профили SAXS являются надежным показателем R g , ν и R ee , а также информируют о степени неоднородности. ( A ) Связывание между R g и R ee , полученное из смоделированных ансамблей с использованием модели H / P (черный) или нашего потенциала, используемого для сворачивания белков (красный). ( B D ) Сравнение R g , ν и R ee , рассчитанных на основе координат смоделированных ансамблей, со значениями, полученными при подгонке с нашим MFF het (R g , ν) с SAXS профили ансамблей со случайно добавленными экспериментальными ошибками.( E ) Отклонения в ν на концах наблюдаются для гетерополимеров с менее хорошо смешанными H / P-образцами (полученными с помощью аппроксимации наклона зависимости внутрицепочечного расстояния R | i — j | от разделение последовательностей, | i — j |, где | i — j |> N / 2). ( F ) Влияние Δν end при различных значениях ν. ( G ) Подбор экспериментальных данных для MFF (R g , ν, Δν конец ) демонстрирует, что мечение флуорофора и образование петли через дисульфидные связи в PNt вызывает значительные и измеримые отклонения.

Чтобы еще больше уменьшить небольшую ошибку, связанную с применением нашего MFF, полученного из гомополимеров, для рассеивания гетерополимеров, мы создали новый молекулярный форм-фактор, MFF het , используя моделирование H / P, описанное выше, и ту же общую процедуру. как описано в исх. 45. Применение этого слегка модифицированного MFF het снижает ошибки в подогнанных R g , ν и R ee до 0,5, 0,005 и 2,7 Å, соответственно, что составляет 1%, 1% и 2% средних значений. абсолютная погрешность (рис.4 B D ). Эти результаты демонстрируют, что наша процедура анализа на основе MFF возвращает точные значения для R g и R ee , которые остаются пропорциональными (т. Е. Связанными) даже для гетерополимеров.

Далее мы рассмотрели вопрос о том, чувствительны ли наши выводы к деталям нашей модели или энергетической функции. Чтобы проверить это, мы провели дополнительное моделирование с использованием более подробной версии алгоритма Upside, который способен сворачивать de novo белки с <100 остатками (54, 55).В этой версии каждая из 20 боковых цепей представлена ​​многопозиционным эксцентриковым валиком, который позволяет детально упаковать сердечник. Энергетическая функция включает водородные связи, взаимодействия боковая цепь-боковая цепь и боковая цепь-основная цепь, аминокислотно-зависимые потенциалы двугранного угла и член десольватации. Используя эту модель, мы сгенерировали 30 ансамблей для каждого из шести белков (PNt и пять других белков, случайно выбранных из 50, описанных выше), используя короткие симуляции, которые выбирают только развернутое состояние.Мы получили ансамбли, выполнив моделирование обмена репликами в диапазоне температур от 280 до 320 К, как описано ранее (54, 55). Значения ν, полученные из этих ансамблей, находились в диапазоне от 0,4 до 0,6 в зависимости от температуры моделирования. Примечательно, что значения R ee , R g и ν, полученные непосредственно из этих более реалистичных ансамблей, находятся в хорошем согласии со значениями, определенными после подгонки с нашим MFF het , с почти такой же точностью, что и для более простого H / P-ансамбли (рис.4 A C , красные точки). Кроме того, непосредственно вычисленные значения для R g и R ee для ансамблей остаются пропорциональными с коэффициентом корреляции R 2 = 0,99. Следовательно, наш вывод, что R g и R ee остаются связанными даже для гетерополимеров, устойчив к деталям нашего моделирования.

Измерение отклонений от идеальности в гетерополимерах.

MFF het точно отражает общие размеры неупорядоченных гетерополимеров для белковоподобных последовательностей H / P и может использоваться в большинстве случаев.Тем не менее, небольшие, но измеримые отклонения наблюдаются для белков в нашем тестовом наборе с менее хорошо смешанными паттернами H / P ( SI, приложение , рис. S4). Эти различия можно увидеть на графике распределения внутримолекулярных расстояний, где наклон на расстояниях разделения | i — j | > N / 2 может отличаться от среднего наклона, который определяет глобальное значение ν (рис. 4 D ). Определим изменение наклона как Δν конец (рис. 4 D ). Отрицательные значения Δν end коррелируют с преобладанием гидрофобных остатков на концах полипептидной последовательности (рис.4 D и SI Приложение , рис. S4 C ) и с отклонениями в G (ν) ( SI Приложение , рис. S4 A ) ( R 2 ∼ 0,84). Профиль SAXS наиболее чувствителен к Δν end при низком qR g (Рис. 4 E ).

Чтобы количественно оценить неидеальность гетерополимеров на основе данных SAXS, мы создали более общий трехпараметрический форм-фактор, MFF general (R g , ν, Δν end ) (рис.4 E и F и Movie S2). Чтобы продемонстрировать его способность давать полезную информацию, мы подобрали данные из PNt, PNtCC-Alexa488 и циркулярного (с дисульфидными связями) PNtCC при 2 M Gdn (рис. 4 F ). Δν конец уменьшается с ∼0 для PNt примерно до -0,1 для PNtCC-Alexa488 и примерно до -0,2 для кольцевых PNtCC, что согласуется с увеличением взаимодействий на аминоконце цепи. Менее резкие возмущения, такие как менее хорошо смешанные паттерны H / P и более короткие аминокислотные последовательности с более низким полезным диапазоном qR g , могут потребовать более высокого отношения сигнал / шум для измерения Δν end .Тем не менее, эти данные демонстрируют потенциал SAXS для выявления для неупорядоченных полимеров зависимых от последовательности отклонений от поведения гомополимера (рис. 4 E и F ), при этом все еще точно измеряя R g и ν (рис. 4 ). А С ).

В пределе бесконечной длины цепи масштабный показатель Флори ν имеет значения 0,33, 0,50 и 0,60, соответствующие глобулам, случайным блужданиям и SARW, соответственно. Тем не менее, мы и другие придерживаемся прагматического подхода и позволяем ν принимать промежуточные значения; е.g., как получено из наклона графиков масштабирования R g в зависимости от длины цепи или R ij в зависимости от | i — j | ( SI Приложение , рис. S6). В поддержку этого подхода можно наблюдать при увеличении силы внутрицепочечного взаимодействия уменьшение как I (q) при высоком q, так и наклона графиков масштабирования для белков из 100-1000 остатков (Fig. 4). Соответственно, мы считаем, что использование значений ν за пределами трех канонических значений обеспечивает законный и практический подход для сравнения качества растворителей для систем разного размера и классификации, является ли вода хорошим или плохим растворителем для полимеров конечной длины.

Обсуждение

В то время как измерения SAXS указывают на то, что вода является хорошим растворителем (ν> 0,5) для развернутых полипептидов, исследования на основе FRET обычно сообщают об обратном (ν <0,5). Однако мы обнаруживаем, что сочетание улучшенных процедур анализа и более тщательного рассмотрения взаимодействий флуорофор-флуорофор и / или флуорофор-цепь достаточно для объяснения этого несоответствия. Эти находки приводят к единой картине, в которой развернутое состояние белков представляет собой SARW при высоком денатуранте и сжимается лишь незначительно (намного меньше, чем ранее сообщалось в литературе FRET) в отсутствие денатуранта.В частности, мы обнаружили, что мечение Alexa-488, широко используемого флуорофора FRET, может изменить конформационный ансамбль IDP, уменьшая R g и ν даже при низкой анизотропии флуоресценции относительно принятых пределов для свободного вращения флуорофора ( 42, 53). В сочетании с предыдущими исследованиями (9) аналогичные выводы можно сделать для PEG, известного SARW. Эти результаты, наряду с нашим предыдущим результатом о том, что неупорядоченные цепи претерпевают умеренное расширение денатуранта (45), и улучшенные методы извлечения значений R g из данных FRET (40, 42–44), теперь обеспечивают достаточную основу для устранения несоответствий. между SAXS и FRET по размерам неупорядоченных белков.Фундаментальный и важный вывод полученной единой картины состоит в том, что даже в отсутствие денатуранта вода остается хорошим растворителем для большинства развернутых белков.

Наши данные об эффектах, индуцированных флуорофором, согласуются с предыдущими выводами о том, что молекулярные размеры, выведенные из FRET, могут зависеть от используемой пары флуорофоров, при этом более гидрофобные флуорофоры приводят к большему сокращению (43). МД-моделирование с парой флуорофоров Alexa-488/594, например, привело к 10% сокращению IDP даже в 1 М мочевины (61).Аналогичным образом, недавнее исследование показало, что сигналы одномолекулярных FRET (smFRET) как от ДНК, так и от PEG зависят от условий растворителя, при которых размеры цепей, как ожидается, будут инвариантными (51). Однако, явно не согласившись с нашими данными, Fuertes et al. (42) провели измерения SAXS на пяти IDP с и без Alexa-488/594 и пришли к выводу, что в среднем изменения, наблюдаемые при добавлении флуорофоров, были минимальными. Однако при рассмотрении каждого белка в отдельности различия кажутся значительными по сравнению с узким диапазоном возможных значений.В частности, для пяти белков, охарактеризованных в этом исследовании, ν без метки — ν метка = 0,08, 0,03, 0,03, -0,02 и -0,04 (или 0,09, 0,06, 0,03, -0,02 и -0,08 при анализе с использованием наши процедуры; SI Приложение , рис. S5). Хотя Fuertes et al. (49) утверждают, что только один белок (NLS) демонстрирует индуцированное флуорофором сокращение, на самом деле четыре из пяти протестированных белков имели статистически значимые индуцированные флуорофором изменения в ν, причем более половины из них демонстрировали сокращение, индуцированное флуорофором (42). величины, аналогичной сокращению, которое мы наблюдали для меченного флуорофором PNt в воде (45) ( SI Приложение , рис.S5). Вместе эти данные подтверждают согласованную картину возмущений, вызванных флуорофором, которые вносят свой вклад в различия в величине и денатурирующей зависимости R g , полученные с помощью SAXS и FRET.

Другой фактор, который, как предполагалось, способствовал расхождению между результатами SAXS и FRET, — это отклонения от пропорциональной зависимости между R g и R ee , которые могут возникнуть при анализе гетерополимеров по сравнению с гомополимерами (42). В основе этой точки зрения лежит наблюдение, что если заново взвесить ансамбль (т.е., вычисляет R g с использованием только подмножества конформаций), многие возможные значения R ee согласуются с любым заданным R g (и наоборот). Вместо того, чтобы выбирать подансамбль конформаций для соответствия паре параметров, мы выбрали альтернативный подход (45). С самого начала мы создаем физически правдоподобные ансамбли, создаем MFF, используя все эти ансамбли, и проверяем, соответствует ли он данным в целом. Мы обнаружили, что наша MFF точно соответствует всему профилю рассеяния (а не только R g ), что обеспечивает надежную поддержку нашей процедуры.Поскольку мы можем вычислить значения R g и R ee непосредственно из базовых ансамблей, у нас есть процедура для получения этих двух параметров путем подгонки данных SAXS с нашим MFF. Мы обнаружили, что для реалистичных денатурированных ансамблей складываемых последовательностей моделируемые пары R g и R ee , а также их аналоги, определенные из профилей рассеяния, пропорциональны ( R 2 > 0,99). Это оставляет красители как источник остающегося несоответствия между SAXS и FRET.

Используемый нами MFF несовершенен в том смысле, что несколько разные ансамбли могут быть подобраны с использованием одних и тех же параметров R g и ν. Но для этих двух параметров ошибка очень мала по сравнению с их истинными значениями (Рис. 4 A C ). Учет эффектов гетерополимера не меняет этого вывода. Из этих результатов мы пришли к выводу, что SAXS хорошо подходит для экстракции как R g , так и R ee для неупорядоченных гетерополимеров, избегая при этом потенциальных артефактов из-за взаимодействий флуорофора с полипептидными цепями.Этот вывод не отрицает возможности FRET для измерения динамики, связывания и конформационных изменений; Однако в нем подчеркивается, что следует проявлять осторожность при использовании FRET для определения количественных расстояний в исходной немеченой биомолекуле.

Почти дюжина наборов данных IDP SAXS, представленных здесь, и ранее (45), как было показано, хорошо подходят для нашего общего MFF ( SI Приложение , таблицы S1 и S3). Это открытие предполагает, что взаимодействия, приводящие к сокращению цепи, распространяются по белковым последовательностям.Водорастворимые, хорошо уложенные белковые последовательности обычно представляют собой хорошо перемешанные гетерополимеры с относительно небольшими участками последовательных гидрофобных остатков (62). Эти хорошо перемешанные последовательности имеют тенденцию вести себя как гомополимеры при измерении глобальными методами с низким разрешением, такими как SAXS. Действительно, мы продемонстрировали, что при достаточном качестве данных плохо смешанные последовательности можно идентифицировать по их отклонению от нашего MFF (Рис. 4 D F ). Большие отклонения могут возникать у некоторых IDP, особенно с частичным сворачиванием, необычным формированием паттерна последовательности (например.g., блок-сополимеры) и / или в условиях тесноты, которые могут выполнять определенные функции (63, 64).

Единая картина, представленная здесь относительно исследований SAXS и FRET развернутого состояния в отсутствие денатуранта, усиливает мнение о том, что вода является хорошим растворителем для большинства развернутых полипептидов, свойство, которое должно уменьшать неправильную укладку и агрегацию, одновременно облегчая синтез и транспорт. То, что большинство белков, тем не менее, легко сворачивается в воде, предполагает, что взаимодействия, управляющие сворачиванием, являются более стабилизирующими, т.е.е. преодолеть способность воды сольватировать развернутое состояние — чем те, которые способствуют неспецифическому коллапсу. Действительно, наблюдение, что, несмотря на минимальные доказательства значительного сокращения развернутого состояния даже при полном отсутствии денатуранта, некоторые белки остаются стабильно свернутыми до 6 M Gdn (41, 65), предполагает, что нативные взаимодействия гораздо более благоприятны, чем любые другие. неспецифические взаимодействия, связанные с коллапсом. Однако, учитывая высокоспецифический характер взаимодействий, образующихся в нативных белках, их способность преодолевать сольватацию развернутой цепи, возможно, не удивительна.

Материалы и методы

PNtCC и PNtC были экспрессированы в Escherichia coli BL21 (DE3) pLysS и очищены от телец включения, как описано ранее (45, 52, 66), со следующими модификациями. После солюбилизации телец включения конструкции PNt повторно укладывали в 50 мМ Tris pH 7,2 с 50 мМ β-меркаптоэтанола (βME). Перед заключительной стадией эксклюзионной хроматографии к исходному белковому раствору добавляли 20 мМ βМЕ.

Дополнительную информацию об алкилировании белков и маркировке Alexa-488, а также об измерениях стационарной анизотропии, анализе данных SAXS и моделировании можно найти в SI Приложение .

Примечание добавлено в доказательство.

Во время обзора было опубликовано исследование, в котором флуорофоры участвовали в усилении аффинности связывания между двумя IDP (83).

Благодарности

Мы благодарим Шриниваса Чакраварти и М. Чемпиона за их помощь в области SAXS и масс-спектрометрии соответственно; и О. Бильзель, Х. С. Чан, С. Такахаши, Р. Бест, Р. Паппу, Д. Тирумалай, Ю. Бай, А. Холхаус, Э. Мартин и Б. Шулер за полезные обсуждения. Работа поддержана грантом NIH Grants GM055694 (Т.R.S.) и GM130122 (для T.R.S. и P.L.C.), Фонд W. M. Keck Foundation (P.L.C.) и Национальный научный фонд гранты GRF DGE-1144082 (для J.A.R.) и MCB 1516959 (для C.R. Matthews, который финансировал периодические встречи между нашими лабораториями). Использование Усовершенствованного источника фотонов, пользовательского объекта Управления науки, находящегося в ведении Управления науки Министерства энергетики (DOE) Аргоннской национальной лабораторией, поддерживалось Министерством энергетики в рамках контракта DEAC02-06Ch21357. Этот проект поддержали NIH 2P41RR008630-18 и 9 P41 GM103622-18.

Сноски

  • Вклад авторов: J.A.R., M.A.B., K.W.P., P.L.C. и T.R.S. спланированное исследование; J.A.R., M.A.B., A.M.Z., P.L.C. и T.R.S. проведенное исследование; J.A.R., M.A.B., P.L.C. и T.R.S. внесены новые реагенты / аналитические инструменты; J.A.R., M.A.B., P.L.C. и T.R.S. проанализированные данные; и J.A.R., M.A.B., K.W.P., P.L.C. и T.R.S. написал газету.

  • Авторы заявляют об отсутствии конфликта интересов.

  • Эта статья представляет собой прямое представление PNAS.

  • Эта статья содержит вспомогательную информацию на сайте www.pnas.org/lookup/suppl/doi:10.1073/pnas.1813038116/-/DCSupplemental.

Биосенсор на основе FRET для количественного определения глюкозы в культуральных супернатантах при культивировании микробов в миллилитровом масштабе | Фабрики микробных клеток

Характеристики сенсора

Концентрация d-глюкозы при культивировании микробов обычно находится в диапазоне от 0 до 200 мМ, что требует сравнительно низкого сродства сенсора d-глюкозы в нижнем миллимолярном диапазоне для определения истощения d-глюкозы.Первый вариант растворимого сенсора, Glu [-] , изучаемый в этой работе, показывает значения K d 0,4 ± 0,1 мМ для d-глюкозы и очень хорошую чувствительность в буфере, что можно вывести из соотношения FRET. изменение (ΔR) 75% между несвязанным и связанным состояниями (дополнительный файл 1: рисунок S1). Таким образом, диапазон обнаружения в буфере MOPS составляет от 0,01 мМ до 10 мМ (от 0,0018 г л -1 до 1,8 г л -1 ) d-глюкозы.

Помимо высокой интенсивности сигнала датчик также должен быть стабильным в условиях микробиореактора, где биосенсор подвергается воздействию температуры и механической нагрузки из-за встряхивания.Сначала была протестирована термическая стабильность сенсора растворимого Glu [-] на предмет его стабильности при различных температурах. В то время как соотношение FRET в присутствии и в отсутствие d-глюкозы оставалось стабильным в течение 21 дня инкубации при 4 ° C и -20 ° C, соответственно, соотношение FRET уже явно изменилось через 3 дня при 25 ° C (рис. 1а), что явно ограничивает применимость этого датчика при комнатной температуре. Таким образом, сеньор подходит для применения в лабораторных условиях со временем культивирования в диапазоне от 24 до 48 часов.Анализ SDS-PAGE показал, что наблюдаемая нестабильность вызвана главным образом возрастающей деградацией слитого белка (рис. 1b). Белок биосенсора распадается на фрагменты размером около 30 кДа (рис. 1b, красный прямоугольник), которые соответствуют размерам как FP, так и центрального MglB, соответственно. Аналогичные результаты были получены и ранее при попытках кристаллизации разных аналогичных сенсоров (данные не показаны). Однако лежащий в основе механизм еще предстоит выяснить.

Рис. 1

Стабильность сенсора Glu [-] (20 мкМ) в буфере MOPS (20 мМ, pH 7.3) при 25 ° С. — соотношение FRET сенсора Glu [-] , демонстрирующее явное свидетельство деградации после инкубации в течение 3 дней. b Анализ SDS-PAGE датчика Glu [-] . Ярлыки над полосами обозначают количество дней инкубации. Размер полноразмерного белка составляет ~ 90 кДа (зеленая рамка). Через 2 дня при 25 ° C датчик начинает распадаться на более мелкие фрагменты ~ 60 кДа (оранжевая рамка, дорожка 3) и ~ 25–30 кДа (красная рамка). Через 4 дня (дорожки 4–11) датчик полностью распадается на фрагмент ~ 25–30 кДа (подробности см. В тексте)

Помимо температуры, датчик должен быть устойчивым также по отношению к различным средам культивирования.Чтобы полностью протестировать применение нового сенсора d-глюкозы для применения с Corynebacterium glutamicum , среда CGXII была протестирована как типичная среда для культивирования [30] на предмет влияния на свойства сенсора. Соответствующая изотерма связывания сенсора Glu [-] , записанная в присутствии культуральной среды, демонстрирует сильное влияние среды CGXII на чувствительность сенсора относительно буфера (см. Дополнительный файл 1: Рисунок S2). Из-за сильного фона и гашения среды CGXII измерения приемлемы только для среды CGXII, разбавленной как минимум 95% буфером (об. / Об.).Кроме того, это разведение позволяет проводить измерения в присутствии клеток C. glutamicum . Таким образом, разделение клеток перед измерением d-глюкозы на линии не требуется. К счастью, среда не повлияла на кажущийся K d варианта сенсора, что указывает на то, что гасящий эффект среды влияет на флуоресцентные белки, а не на MglB (дополнительный файл 1: Рисунок S2). Пределы обнаружения от 0,01 мМ до 10 мМ (от 0,0018 г л -1 до 1,8 г л -1 ) d-глюкозы, однако, можно смещать путем разбавления образцов культивирования.Разбавление в 40 раз позволило бы количественно определить d-глюкозу от 0,4 мМ до 400 мМ (от 0,072 до 72 г л -1 ), что охватывает диапазон концентраций большинства культивирований микробов.

Еще одним предварительным условием для применения таких датчиков является воспроизводимость калибровок во время типичного эксперимента по выращиванию, что указывает на их стабильность в условиях процесса. Повторные сравнительные калибровки в буфере MOPS в присутствии и в отсутствие среды CGXII (2,5% об. / Об., Разведение 1:40) не показали значительного влияния на кажущееся сродство (K d ) и интенсивность сигнала Glu. [-] датчик.Как показано на рис. 2, изотермы связывания оставались стабильными на протяжении всего эксперимента, демонстрируя, что этот датчик может использоваться для повторных измерений.

Рис. 2

Изотерма связывания биосенсора Glu [-] в любом MOPS (20 мМ, pH 7,3) ( a ) со средой CGXII (2,5% об.) И ( b ) без добавление среды без встряхивания. FRET-соотношение (I A / I D ) было рассчитано на основе выбросов донора mTurquoise2 на 485 нм (± 20 нм) и акцептора Венеры на 528 нм (± 20 нм) после возбуждения донора на 428 нм. нм (± 9 нм) согласно формуле.(1). Между измерениями датчик хранился в защищенном от света месте при температуре 4 ° C. Кривые (пунктирные) были подогнаны к данным согласно формуле. (2)

Помимо термической деградации и воздействия среды, также встряхивание сенсора Glu [-] в цветочных пластинах ® устройства BioLector ® оказалось вредным, поскольку эмиссия обоих партнеров FRET значительно снизилась (см. Дополнительный файл 1: Рисунок S5). Уменьшение обеих интенсивностей излучения указывает на деградацию по крайней мере донора и, скорее всего, акцептора.Кроме того, частота встряхивания> 800 об / мин приводила к агрегированию датчика Glu [-] (данные не показаны). Агрегированный сенсор больше не реагировал на изменения концентрации d-глюкозы, что делало сенсор Glu [-] непригодным для онлайн-применения во встряхиваемых культурах. Однако растворимый сенсор Glu [-] может применяться в автоматизированном процессе для измерения d-глюкозы на линии. При такой настройке запас биосенсора можно легко хранить при температуре 4 ° C между измерениями, что значительно увеличивает срок его службы.Кроме того, датчик Glu [-] не будет подвергаться тряске, что способствует стабильности датчика.

Прямое нанесение растворимого сенсора Glu

[-]

При наличии достаточно стабильного сенсора и воспроизводимой калибровки был разработан поточный протокол количественного определения d-глюкозы для широко используемого производственного штамма Corynebacterium glutamicum (см. Дополнительный файл 1: Рисунок S7). Во время культивирования C. glutamicum ATCC 13032 в BioLector ® в режиме онлайн отслеживали рост биомассы, потребление кислорода и изменения pH.Как описано в разделе «Методы», каждый час с помощью системы обработки жидкости отбирали три образца, разбавляли и измеряли концентрацию d-глюкозы с помощью биосенсора Glu [-] (см. Дополнительный файл 1: Рисунок S8 для калибровки). Супернатант оставшихся образцов хранили при 4 ° C для сравнительной автономной аналитики с использованием ВЭЖХ и ферментативного анализа d-глюкозы [2].

Как показано на фиг. 3, сенсорный анализ Glu [-] работал очень хорошо и отражал потребление d-глюкозы в соответствии с анализами HPLC и ферментативного анализа.Примечательно, что измерение проводилось в присутствии бактериальных клеток с использованием небольшого количества образца (15 мкл) и очень короткого времени инкубации (<1 мин). Эти свойства способствуют быстрому процессу измерения, и, таким образом, наш рабочий процесс позволяет количественно определять d-глюкозу в большом количестве образцов во время выполнения процесса культивирования.

Рис. 3

Рост биомассы ( a ) и потребление d-глюкозы C. glutamicum ATCC 13032 в среде CGXII с последующим использованием ( b ) сенсора Glu [-] ( c ) ферментативный анализ d-глюкозы и ( d ) анализ ВЭЖХ.В то время как сенсорный анализ можно было проводить в режиме реального времени, ферментативные анализы и анализы ВЭЖХ проводились в автономном режиме после завершения культивирования. Каждая кривая напоминает биологическую копию. Планки погрешностей представляют собой стандартное отклонение (SD) в трех технических повторах

Ферментативные анализы обычно используются для количественного определения d-глюкозы в образцах микробных культур [2, 3], а также могут использоваться в автоматизированной поточной установке [33]. Однако есть ярко выраженные недостатки: во-первых, они требуют предварительного отделения бактериальных клеток, часто с помощью центрифугирования или фильтрации.Это усложняет рабочий процесс, отнимает больше времени и требует сложной платформы для обработки жидкостей. Напротив, для сенсорного анализа d-глюкозы требуются только этапы разбавления, которые можно быстро выполнить с помощью стандартных операций с жидкостью. Во-вторых, ферментные анализы включают этапы инкубации от 10 мин [34] до 30 мин [2]. Хотя этот трудоемкий этап не вызывает проблем при параллельной обработке большого количества выборок, он ограничивает интервал измерений на линии. Например, предыдущее исследование продемонстрировало измерение d-глюкозы на линии с помощью ферментативного анализа с 80-минутными интервалами [33].С другой стороны, биосенсор Glu [-] немедленно реагирует на d-глюкозу в окружающей среде, в том числе в присутствии клеток, что открывает путь к очень коротким циклам измерения и, таким образом, увеличивает плотность данных.

Насколько нам известно, в настоящее время не существует метода поточной ВЭЖХ для микробиореакторов из-за длительного времени удерживания и иногда сложной подготовки образцов [35]. Несмотря на то, что подготовку образцов путем фильтрации можно легко автоматизировать, недостаток измерения только одного образца за раз серьезно препятствует применению методов ВЭЖХ на линии при культивировании в микробиореакторах, которые часто включают множественные параллельные культивирования.Однако хроматографические методы имеют преимущество измерения нескольких аналитов за один проход.

Иммобилизация

После успешной настройки протокола измерения на линии в среде CGXII, мы остановились на приложении для онлайн-измерений. Как показано выше, растворимый сенсор Glu [-] не обладает долговременной стабильностью при температурах выше 25 ° C и подвержен механическим воздействиям. Нельзя избежать механического стресса, так как перемешивание необходимо для любого микробного культивирования, чтобы гарантировать достаточное перемешивание и, в случае аэробных культивирований, перенос кислорода.Таким образом, стабильность датчика должна быть улучшена. Первоначальные исследования иммобилизации с помощью His-tag не увенчались успехом, поскольку хелатная связь Co 2+ с гранулами диоксида кремния, функционализированными нитрилотриуксусной кислотой (Dynabeads, ThermoScientific), не была стабильной в условиях процесса (данные не показаны). Альтернативным подходом является иммобилизация с помощью HaloTag ® [21], который обеспечивает ковалентную иммобилизацию и очистку в одну стадию, начиная также непосредственно с сырых клеточных экстрактов, что недавно было успешно продемонстрировано для иммобилизации различных ферментов [22, 36, 37 ].

Слияние HaloTag ® с C-концом сенсора d-глюкозы привело к сенсору Glu [+ Halo] . Это слияние уменьшило общее соотношение FRET, а также ΔR в растворе с 75% до почти 40% по сравнению с датчиком Glu [-] . Однако после иммобилизации датчик Glu [+ Halo] восстанавливает функциональность и высокую интенсивность сигнала (ΔR 74%) датчика Glu [-] (подробности см. В дополнительном файле 1: Рисунок S1). Этот удивительный результат можно объяснить следующим образом: как мы показали ранее, эффективность FRET (интенсивность сигнала) сильно зависит от расстояния и гибкости донорного FP mTurquoise2 относительно центрального связывающего глюкозу белка (MglB) [20].Из-за аналогичного размера FP и HaloTag ® (около 30 кДа) нельзя исключить отрицательные стерические эффекты C-концевого HaloTag ® в растворимой рецептуре сенсора, что могло бы объяснить снижение общей эффективности переноса. как показано в спектрах излучения (рис. 4). Здесь пониженная эффективность переноса отражается в уменьшенном излучении акцепторной Венеры после возбуждения донора mTurquoise2 (λ ex = 425 ± 9 нм). Поскольку HaloTag ® расположен на С-конце сенсора, белок, вероятно, искажается, тем самым изменяя расстояние и / или ориентацию между донором и акцептором.Иммобилизация на поверхности шариков Sepharose ® , по-видимому, снижает взаимодействие HaloTag ® с партнерами FRET, что приводит к восстановлению функциональности. Примечательно, что на сродство (K d ) датчика не влияет ни добавление метки, ни иммобилизация. В растворимом составе, а также в иммобилизованной форме сродство оставалось в том же диапазоне (0,8 мМ ± 0,2 мМ), что указывает на то, что HaloTag ® не влияет на сайт связывания d-глюкозы (дополнительный файл 1: рисунок S1).

Рис. 4

Спектры излучения датчика Glu [+ Halo] ( a ) не иммобилизованного и ( b ) иммобилизованного на смоле HaloLink ® . Спектры получали после возбуждения FRET-донора mTurquoise2 при λ ex = 425 нм (± 9 нм) в присутствии (черная кривая) и отсутствии (серая кривая) 1 М d-глюкозы. Интенсивности нормированы на излучение при 485 нм (λ em м бирюзовый2)

По сравнению с другими методами иммобилизации для таких датчиков, такими как инкапсуляция, сайт-ориентированная иммобилизация с помощью HaloTag ® не уступает ни гибкости, ни отрицательно сказывается доступность обездвиженного датчика.В предыдущем исследовании аналогичный датчик d-глюкозы на основе FRET был инкапсулирован в частицы кремнезема, что значительно снизило интенсивность FRET [38]. Кроме того, биосенсор может быть иммобилизован непосредственно из неочищенного клеточного экстракта, что позволяет избежать трудоемкой и дорогостоящей хроматографической очистки белка [39].

Онлайн-применение иммобилизованного сенсора Glu

[+ Halo]

С сенсором Glu [+ Halo] , ковалентно иммобилизованным на поверхности шариков сефарозы ® , устойчивость сенсора к механическим воздействиям была значительно увеличена , что было необходимым условием для применения этих гранул непосредственно в культивировании микробов (дополнительный файл 1: Рисунок S6).Хотя иммобилизация решает проблемы стабильности, тушение среды CGXII остается. Кроме того, возрастающая концентрация C. glutamicum также приводит к увеличению фона из-за аутофлуоресценции [40]. Чтобы преодолеть это, иммобилизованный сенсор Glu [+ Halo] был протестирован в среде M9, типичной культуральной среде для Escherichia coli [32]. Несмотря на снижение ΔR до 35%, изменение отношения FRET заметно (см. Дополнительный файл 1: Рисунок S3).Как следствие, измерения в среде M9 можно проводить с датчиком непосредственно в культивировании, что упрощает онлайн-приложение.

Результаты онлайн-применения иммобилизованного сенсора Glu [+ Halo] во время культивирования E. coli K12 MG1655 в среде M9 показаны на рис. 5. На протяжении всего культивирования отслеживались оба флуоресцентных сигнала сенсора. с помощью BioLector ® и был рассчитан FRET-коэффициент (I A / I D ).Затем рассчитывалась внеклеточная концентрация d-глюкозы на основе отношения FRET и калибровки иммобилизованного сенсора Glu [+ Halo] в той же среде в той же цветочной пластине (см. Дополнительный файл 1: Рисунок S9 для калибровки). . За потреблением d-глюкозы можно было следить в течение всего эксперимента по культивированию (20 ч). Здесь датчик Glu [+ Halo] имел диапазон обнаружения от 0,02 до 2 мМ (от 0,0036 до 0,36 г л -1 ). В соответствии с этим диапазоном после истощения d-глюкозы (через 18 ч) дальнейшее изменение сигнала FRET не могло быть обнаружено.Несмотря на то, что в среде не осталось d-глюкозы, биомасса увеличилась еще больше, предположительно в результате метаболизма переполнения [41].

Рис.5

FRET-соотношение ( a ), истощение глюкозы ( b ) и рост биомассы ( c ) при культивировании E. coli в среде M9, измеренные с помощью иммобилизованного биосенсора на основе FRET на смоле HaloLink ® . Коэффициент FRET использовался для расчета текущей концентрации d-глюкозы на основе калибровки иммобилизованного сенсора (см. Дополнительный файл 1: Рисунок S9)

Преимущество онлайн-измерения согласуется с недостатком ограничения определенным измерительным окном, определяемым динамическим диапазоном датчика.В отличие от измерений на месте, где конечная концентрация d-глюкозы в образцах может быть адаптирована к сродству сенсора, для онлайн-измерений требуются либо сенсоры с более широким динамическим диапазоном, либо другие сенсоры с соответствующим сродством, чтобы охватить более широкий диапазон концентраций целевого метаболита. . Сродство сенсора d-глюкозы можно регулировать либо соответствующей аминокислотной заменой в связывающих глюкозу белках [24, 42, 43], выбирая альтернативные связывающие глюкозу белки с более низким сродством [44, 45], либо вставляя линкер. последовательности [9, 20].Поскольку до сих пор не известен сенсор на основе FRET с очень широким диапазоном обнаружения [7], комбинация нескольких сенсоров d-глюкозы с разным сродством и пар FRET, иммобилизованных на одном носителе, может рассматриваться как расширение диапазона обнаружения.

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с вашим системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Аптамеры и FRET-биосенсоры на основе наноматериалов: обзор последних достижений (2014–2019)

  • 1.

    Qiu X, Hildebrandt N (2015) Быстрый и мультиплексный диагностический анализ микроРНК с использованием квантовых точек переноса энергии резонанса Ферстера.ACS Nano 9: 8449–8457. https://doi.org/10.1021/acsnano.5b03364

    CAS Статья PubMed Google ученый

  • 2.

    He L, Lu D-Q, Liang H et al (2017) Нанопинцет-тетраэдр ДНК на основе флуоресцентного резонанса с переносом энергии для высоконадежного обнаружения мРНК, связанной с опухолями, в живых клетках. ACS Nano 11: 4060–4066. https://doi.org/10.1021/acsnano.7b00725

    CAS Статья PubMed PubMed Central Google ученый

  • 3.

    Мединц I, Хильдебрандт Н. (2014) FRET — Фёрстеровский резонансный перенос энергии. Wiley-VCH Verlag GmbH & Co, KGaA, Weinheim

    Google ученый

  • 4.

    Клегг Р.М. (1992) [18] Флуоресцентный резонансный перенос энергии и нуклеиновые кислоты. В кн .: Методы энзимологии. Academic Press, pp. 353–388

  • 5.

    Rowland CE, Brown CW, Medintz IL, Delehanty JB (2015) Внутриклеточные зонды на основе FRET: обзор. Методы Appl Fluoresc 3: 042006.https://doi.org/10.1088/2050-6120/3/4/042006

    CAS Статья PubMed Google ученый

  • 6.

    Хуссейн С.А. (2012) Введение в флуоресцентный резонансный перенос энергии (FRET). В: arXiv.org. https://arxiv.org/abs/0908.1815

  • 7.

    Густ А., Зандер А., Гитл А. и др. (2014) Отправная точка для основанных на флуоресценции измерений одиночных молекул в биомолекулярных исследованиях.Molecules 19: 15824–15865. https://doi.org/10.3390/molecules1824

    CAS Статья PubMed PubMed Central Google ученый

  • 8.

    Wen Y, Xing F, He S et al (2010) Флуоресцентный нанозонд на основе графена для обнаружения ионов серебра (i) с использованием оксида графена и серебряного олигонуклеотида. Chem Commun 46: 2596. https://doi.org/10.1039/b

    2c

    CAS Статья Google ученый

  • 9.

    Kurt H, Alpaslan E, Yildiz B et al (2017) Конформационно-опосредованный резонансный перенос энергии Фёрстера (FRET) в излучающих синий поливинилпирролидон (PVP) -пассивированных наночастицах оксида цинка (ZnO). J Colloid Interface Sci 488: 348–355. https://doi.org/10.1016/j.jcis.2016.11.017

    CAS Статья PubMed Google ученый

  • 10.

    Das P, Sedighi A, Krull UJ (2018) Определение биомаркера рака путем резонансной передачи энергии с использованием функциональных флуоресцентных нанозондов.Анальный Чим Acta 1041: 1–24. https://doi.org/10.1016/j.aca.2018.07.060

    CAS Статья PubMed Google ученый

  • 11.

    Амири С., Ахмади Р., Салими А. и др. (2018) Сверхчувствительный и высокоселективный аптасенсор FRET для измерения Hg 2+ в образцах рыб с использованием углеродных точек / AuNP в качестве донорной / акцепторной платформы. Новый J Chem 42: 16027–16035. https://doi.org/10.1039/C8NJ02781A

    CAS Статья Google ученый

  • 12.

    Кумар YVVA, Р. Р., А. Дж. И др. (2018) Разработка флуоресцентного аптасенсора на основе FRET для обнаружения афлатоксина B1 в загрязненных образцах пищевого зерна. RSC Adv 8: 10465–10473. https://doi.org/10.1039/C8RA00317C

    Артикул Google ученый

  • 13.

    Hildebrandt N, Spillmann CM, Algar WR et al (2017) Передача энергии с помощью полупроводниковых биоконъюгатов с квантовыми точками: универсальная платформа для биосенсоров, сбора энергии и других приложений для разработки.Chem Rev.117: 536–711. https://doi.org/10.1021/acs.chemrev.6b00030

    CAS Статья PubMed Google ученый

  • 14.

    Li Z, He M, Xu D, Liu Z (2014) Системы и сенсоры акцепторов энергии на основе графеновых материалов. J Photochem Photobiol C Photochem Rev. 18: 1–17. https://doi.org/10.1016/j.jphotochemrev.2013.10.002

    CAS Статья Google ученый

  • 15.

    Гейсслер Д., Линден С., Лирманн К. и др. (2014) Лантаноиды и квантовые точки как агенты передачи энергии резонанса Ферстера для диагностики и визуализации клеток. Inorg Chem 53: 1824–1838. https://doi.org/10.1021/ic4017883

    CAS Статья PubMed Google ученый

  • 16.

    Zu F, Yan F, Bai Z et al (2017) Тушение флуоресценции углеродных точек: обзор механизмов и приложений. Microchim.Acta 184: 1899–1914

    CAS Статья Google ученый

  • 17.

    Хан И.М., Чжао С., Ниази С. и др. (2018) Аптасенсор FRET на основе нанокластеров серебра для чувствительного и селективного флуоресцентного обнаружения токсина Т-2. Датчики Актуаторы B Chem 277: 328–335. https://doi.org/10.1016/j.snb.2018.09.021

    CAS Статья Google ученый

  • 18.

    Marx V (2017) Зонды: разработка и оптимизация датчика FRET.Нат Методы 14: 949–953. https://doi.org/10.1038/nmeth.4434

    CAS Статья PubMed Google ученый

  • 19.

    Арруэбо М., Валладарес М., Гонсалес-Фернандес Б. (2009) Наночастицы, конъюгированные с антителами, для биомедицинских приложений. J Nanomater 2009: 1-24. https://doi.org/10.1155/2009/439389

    CAS Статья Google ученый

  • 20.

    Yüce M, Ullah N, Budak H (2015) Тенденции в методах и применениях выбора аптамеров. Аналитик 140: 5379–5399. https://doi.org/10.1039/C5AN00954E

    CAS Статья PubMed Google ученый

  • 21.

    Юсе М., Курт Х (2017) Как создавать нанобиосенсоры: модификация поверхности и характеристика наноматериалов для приложений биосенсоров. RSC Adv 7: 49386–49403. https://doi.org/10.1039/C7RA10479K

    Артикул Google ученый

  • 22.

    Mallikaratchy P (2017) Эволюция комплексной мишени SELEX для идентификации аптамеров против антигенов клеточной поверхности млекопитающих. Молекулы 22: 215. https://doi.org/10.3390/molecules22020215

    CAS Статья PubMed Central Google ученый

  • 23.

    Sun N, Ding Y, Tao Z et al (2018) Разработка ДНК-зонда с апконверсией флуоресценции для обнаружения ацетамиприда путем разделения магнитных наночастиц.Food Chem 257: 289–294. https://doi.org/10.1016/j.foodchem.2018.02.148

    CAS Статья PubMed Google ученый

  • 24.

    Srinivasan S, Ranganathan V, DeRosa MC, Murari BM (2018) Аптасенсоры без метки, основанные на флуоресцентных скрининговых анализах для обнаружения Salmonella typhimurium. Анальная биохимия 559: 17–23. https://doi.org/10.1016/j.ab.2018.08.002

    CAS Статья PubMed Google ученый

  • 25.

    Yüce M, Kurt H, Hussain B, Budak H (2018) Систематическая эволюция лигандов путем экспоненциального обогащения для выбора аптамера. В: Sarmento B, Das NJ (eds) Biomedical Applications of Functionalized Nanomaterials, 1st edn. Elsevier, pp. 211–243

  • 26.

    Курт Х., Юсе М., Хусейн Б., Будак Х. (2016) Аптасенсор наночастиц и квантовых точек с двойным возбуждением, повышающий преобразование частоты, для множественного обнаружения пищевых патогенов. Biosens Bioelectron 81: 280–286. https://doi.org/10.1016/j.bios.2016.03.005

    CAS Статья PubMed Google ученый

  • 27.

    Yüce M, Kurt H, Hussain B et al (2018) Использование стоксовых и антистоксовых профилей излучения люминесцентных нанозондов, функционализированных аптамером, для приложений мультиплексного зондирования. ChemistrySelect 3: 5814–5823. https://doi.org/10.1002/slct.201801008

    CAS Статья Google ученый

  • 28.

    Woo H-M, Lee J-M, Yim S, Jeong Y-J (2015) Выделение аптамеров одноцепочечной ДНК, которые отличают подтип h2 гемагглютинина вируса гриппа от H5.PLoS One 10: e0125060. https://doi.org/10.1371/journal.pone.0125060

    CAS Статья PubMed PubMed Central Google ученый

  • 29.

    Ким М., Ум Х.-Дж., Банг С. и др. (2009) Удаление мышьяка из подземных вод Вьетнама с использованием связывающего мышьяк ДНК-аптамера. Environ Sci Technol 43: 9335–9340. https://doi.org/10.1021/es

    7g

    CAS Статья PubMed Google ученый

  • 30.

    Savory N, Lednor D, Tsukakoshi K et al (2013) In silico созревание специфичности связывания ДНК-аптамеров против Proteus mirabilis . Biotechnol Bioeng 110: 2573–2580. https://doi.org/10.1002/bit.24922

    CAS Статья PubMed Google ученый

  • 31.

    Li Z, Uzawa T., Tanaka T. et al (2013) Выбор in vitro пептидных аптамеров со сродством к одностенным углеродным нанотрубкам с использованием рибосомного дисплея.Biotechnol Lett 35: 39–45. https://doi.org/10.1007/s10529-012-1049-6

    CAS Статья PubMed Google ученый

  • 32.

    Лим Ю.К., Кузани А.З., Дуан В. (2009) Аспекты проектирования датчиков Aptasensors. В: Коммуникации в компьютерных и информационных науках, стр. 118–127

    . Google ученый

  • 33.

    Chandra P, Noh H-B, Won M-S, Shim Y-B (2011) Обнаружение дауномицина с использованием фосфатидилсерина и аптамера, совместно иммобилизованных на наночастицах Au, нанесенных на проводящий полимер.Biosens Bioelectron 26: 4442–4449. https://doi.org/10.1016/j.bios.2011.04.060

    CAS Статья PubMed Google ученый

  • 34.

    Чжао В., Чиуман В., Брук М.А., Ли Ю. (2007) Простые и быстрые колориметрические биосенсоры на основе ДНК-аптамера и несшивающей агрегации наночастиц золота. ChemBioChem 8: 727–731. https://doi.org/10.1002/cbic.200700014

    CAS Статья PubMed Google ученый

  • 35.

    Yang CJ, Jockusch S, Vicens M et al (2005) Эксимерные зонды с переключением света для быстрого мониторинга белков в сложных биологических жидкостях. Proc Natl Acad Sci 102: 17278–17283. https://doi.org/10.1073/pnas.0508821102

    CAS Статья PubMed Google ученый

  • 36.

    Khati M (2010) Будущее аптамеров в медицине. Дж. Клин Патол 63: 480–487. https://doi.org/10.1136/jcp.2008.062786

    CAS Статья PubMed Google ученый

  • 37.

    Донг Х., Гао В., Ян Ф. и др. (2010) Передача энергии резонанса флуоресценции между квантовыми точками и оксидом графена для восприятия биомолекул. Anal Chem 82: 5511–5517. https://doi.org/10.1021/ac100852z

    CAS Статья PubMed Google ученый

  • 38.

    Дарбанди А., Датта Д., Патель К. и др. (2017) Молекулярный маяк, закрепленный на подложке из оксида графена. Нанотехнологии 28: 375501. https://doi.org/10.1088 / 1361-6528 / aa7e50

    CAS Статья PubMed Google ученый

  • 39.

    Гош С., Датта Д., Чима М. и др. (2017) Оптическое определение гликированного альбумина на основе аптасенсора для диагностики сахарного диабета. Нанотехнологии 28: 435505. https://doi.org/10.1088/1361-6528/aa893a

    CAS Статья PubMed Google ученый

  • 40.

    Li S, Xu L, Ma W и др. (2016) Двухрежимная сверхчувствительная количественная оценка микроРНК в живых клетках с помощью хироплазмонных нанопирамид, самоорганизующихся из золота и наночастиц с повышенным преобразованием. J Am Chem Soc 138: 306–312. https://doi.org/10.1021/jacs.5b10309

    CAS Статья PubMed Google ученый

  • 41.

    Li M, Zhou X, Guo S, Wu N (2013) Обнаружение свинца (II) с помощью «включаемого» флуоресцентного биосенсора на основе передачи энергии от квантовых точек CdSe / ZnS на оксид графена.Biosens Bioelectron 43: 69–74. https://doi.org/10.1016/j.bios.2012.11.039

    CAS Статья PubMed Google ученый

  • 42.

    Джин Б., Ван С., Лин М. и др. (2017) Аптасенсор FRET на основе наночастиц с повышающим преобразованием для быстрого и сверхчувствительного обнаружения бактерий. Biosens Bioelectron 90: 525–533. https://doi.org/10.1016/j.bios.2016.10.029

    CAS Статья PubMed Google ученый

  • 43.

    Yang W, Zhang G, Weng W et al (2014) Сигнал флуоресцентного биосенсора для MMP-2 на основе FRET между точками полупроводникового полимера и металлоорганическим каркасом. RSC Adv 4: 58852–58857. https://doi.org/10.1039/C4RA12478B

    CAS Статья Google ученый

  • 44.

    Ван И, Бао Л., Лю З., Панг Д. В. (2011) Аптамерный биосенсор на основе передачи энергии резонанса флуоресценции от повышающего преобразования фосфора к углеродным наночастицам для обнаружения тромбина в плазме человека.Anal Chem 83: 8130-8137. https://doi.org/10.1021/ac201631b

    CAS Статья PubMed Google ученый

  • 45.

    Li X-HH, Sun W-MM, Wu J et al (2018) Сверхчувствительный флуоресцентный аптасенсор для обнаружения карцино-эмбрионального антигена, основанный на передаче резонансной энергии флуоресценции от люминофоров с повышающим преобразованием к наночастицам Au. Анальные методы 10: 1552–1559. https://doi.org/10.1039/C7AY02803B

    CAS Статья Google ученый

  • 46.

    Ueno Y, Furukawa K, Tin A, Hibino H (2015) Встроенный FRET-аптасенсор оксида графена: количественная оценка повышенной чувствительности аптамером с двухцепочечным спейсером ДНК. Anal Sci 31: 875–879. https://doi.org/10.2116/analsci.31.875

    CAS Статья PubMed Google ученый

  • 47.

    Jiang H, Ling K, Tao X, Zhang Q (2015) Обнаружение теофиллина в сыворотке с помощью самособирающегося датчика наночастиц золота на основе аптамера РНК.Biosens Bioelectron 70: 299–303. https://doi.org/10.1016/j.bios.2015.03.054

    CAS Статья PubMed Google ученый

  • 48.

    Ким Б., Малиутов Д.М., Варшней К.Р., Веллер А. (2017) Труды семинара ICML 2017 года по интерпретируемости человеком в машинном обучении (WHI 2017). Новый J Chem 37: 3998. https://doi.org/10.1039/c3nj00594a

  • 49.

    Ахар М.Дж. (2017) Обзор наносистем с квантовыми точками, конъюгированных с аптамером, для визуализации рака и тераностики.J Nanomedicine Res 5. https://doi.org/10.15406/jnmr.2017.05.00117

  • 50.

    Michalet X (2005) Квантовые точки для живых клеток, визуализация in vivo и диагностика. Наука (80-) 307: 538–544. https://doi.org/10.1126/science.1104274

    CAS Статья Google ученый

  • 51.

    Zeng Z, Garoufalis CS, Terzis AF, Baskoutas S (2013) Линейные и нелинейные оптические свойства квантовых точек ядра ZnO / ZnS и ZnS / ZnO: влияние толщины оболочки, примесей и диэлектрической среды.J. Appl Phys 114: 023510. https://doi.org/10.1063/1.4813094

    CAS Статья Google ученый

  • 52.

    Васудеван Д., Гаддам Р. Р., Тринчи А., Коул I (2015) Квантовые точки ядро ​​– оболочка: свойства и приложения. Дж. Сплавы. Compd 636: 395–404. https://doi.org/10.1016/j.jallcom.2015.02.102

    CAS Статья Google ученый

  • 53.

    Fang B-Y, Wang C-Y, Li C et al (2017) Амплифицировано с использованием ДНКазы I и аптамера / оксида графена для определения специфического антигена простаты в сыворотке крови человека. Датчики Актуаторы B Chem 244: 928–933. https://doi.org/10.1016/j.snb.2017.01.045

    CAS Статья Google ученый

  • 54.

    Medintz IL, Uyeda HT, Goldman ER, Mattoussi H (2005) Биоконъюгаты на квантовых точках для визуализации, маркировки и зондирования. Nat Mater 4: 435–446.https://doi.org/10.1038/nmat1390

    CAS Статья PubMed Google ученый

  • 55.

    Zhang C, Ding C, Zhou G et al (2017) Одностадийный синтез функционализированных ДНК квантовых точек без кадмия и его применение для определения белков на основе FRET. Анальный Чим Acta 957: 63–69. https://doi.org/10.1016/j.aca.2016.12.024

    CAS Статья PubMed Google ученый

  • 56.

    Арванд М., Миррошандель А.А. (2017) Высокочувствительный аптасенсор на основе флуоресцентного резонансного переноса энергии между квантовыми точками ZnS, закрытыми l-цистеином, и листами оксида графена для определения фунгицида эдифенфоса. Biosens Bioelectron 96: 324–331. https://doi.org/10.1016/j.bios.2017.05.028

    CAS Статья PubMed Google ученый

  • 57.

    Дуан Н., Ву С., Дай С. и др. (2015) Одновременное обнаружение патогенных бактерий с помощью биосенсора на основе аптамера и двойной резонансный перенос энергии флуоресценции от квантовых точек на углеродные наночастицы.Microchim Acta 182: 917–923. https://doi.org/10.1007/s00604-014-1406-3

    CAS Статья Google ученый

  • 58.

    Das P, Krull UJ (2017) Обнаружение белка биомаркера рака на модифицированной целлюлозной бумаге флуоресценцией с использованием квантовых точек, связанных аптамером. Аналитик 142: 3132–3135. https://doi.org/10.1039/c7an00624a

    CAS Статья PubMed Google ученый

  • 59.

    Sabet FS, Hosseini M, Khabbaz H et al (2017) Аптамерный биосенсор на основе FRET для селективного и чувствительного обнаружения афлатоксина B1 в арахисе и рисе. Food Chem 220: 527–532. https://doi.org/10.1016/j.foodchem.2016.10.004

    CAS Статья PubMed Google ученый

  • 60.

    Хильдебрандт Н., Шарбоньер Л.Дж., Бек М. и др. (2005) Квантовые точки как эффективные акцепторы энергии в фторированном иммуноанализе с временным разрешением.Angew Chemie Int Ed. 44: 7612–7615. https://doi.org/10.1002/anie.200501552

    CAS Статья Google ученый

  • 61.

    So M-K, Xu C, Loening AM et al (2006) Самосветящиеся конъюгаты квантовых точек для визуализации in vivo. Nat Biotechnol 24: 339–343. https://doi.org/10.1038/nbt1188

    CAS Статья PubMed Google ученый

  • 62.

    Doughan S, Uddayasankar U, Krull UJ (2015) Анализ гибридизации нуклеиновых кислот с резонансным переносом энергии на бумаге с использованием наночастиц с повышающим преобразованием в качестве доноров и квантовых точек в качестве акцепторов. Анальный Чим Acta 878: 1–8. https://doi.org/10.1016/j.aca.2015.04.036

    CAS Статья PubMed Google ученый

  • 63.

    Qiu X, Guo J, Jin Z et al (2017) Мультиплексные тесты гибридизации нуклеиновых кислот с использованием настройки расстояния для одной пары FRET.Маленький 13: 1700332. https://doi.org/10.1002/smll.201700332

    CAS Статья Google ученый

  • 64.

    Qiu X, Guo J, Xu J, Hildebrandt N (2018) Трехмерное мультиплексирование FRET для количественной оценки ДНК с предельными значениями аттомолярного обнаружения. J. Phys Chem Lett. 9: 4379–4384. https://doi.org/10.1021/acs.jpclett.8b01944

    CAS Статья PubMed Google ученый

  • 65.

    Qiu X, Xu J, Guo J et al (2018) Расширенная диагностика рака на основе микроРНК с использованием усиленного FRET с временной синхронизацией. Chem Sci 9: 8046–8055. https://doi.org/10.1039/C8SC03121E

    CAS Статья PubMed PubMed Central Google ученый

  • 66.

    Guo J, Qiu X, Mingoes C et al (2019) Конформационные детали квантовой точечной ДНК, разрешенные с помощью наноруллера с резонансным переносом энергии Фёрстера. ACS Nano 13: 505–514.https://doi.org/10.1021/acsnano.8b07137

    CAS Статья PubMed Google ученый

  • 67.

    Дуган С., Хан Й., Уддаясанкар У., Крулл У. Дж. (2014) Твердофазная ковалентная иммобилизация повышающих преобразование наночастиц для биочувствительности путем резонансной передачи энергии люминесценции. Интерфейсы приложения ACS Mater 6: 14061–14068. https://doi.org/10.1021/am503391m

  • 68.

    Li Y, Xu J, Wang L et al (2016) Флуоресцентное обнаружение бисфенола A на основе аптамеров с использованием неконъюгированных наночастиц золота и квантовых точек CdTe.Датчики-приводы, B Chem 222: 815–822. https://doi.org/10.1016/j.snb.2015.08.130

    Артикул Google ученый

  • 69.

    Tianyu H, Xu Y, Weidan N, Xingguang S (2016) Анализ агрегации ртути (II) на основе аптамеров с использованием наночастиц золота и флуоресцентных квантовых точек CdTe. Microchim Acta 183: 2131–2137. https://doi.org/10.1007/s00604-016-1831-6

    CAS Статья Google ученый

  • 70.

    Lu X, Wang C, Qian J et al (2019) Управляемый мишенью включающий флуоресцентный аптасенсор для определения следов афлатоксина B1 на основе высоко флуоресцентных тройных квантовых точек CdZnTe. Анальный Чим Acta 1047: 163–171. https://doi.org/10.1016/j.aca.2018.10.002

    CAS Статья PubMed Google ученый

  • 71.

    Kavosi B, Navaee A, Salimi A (2018) Усиленное определение резонансного переноса энергии флуоресценции простатического специфического антигена на основе агрегации квантовых точек CdTe / антител и аптамера, декорированного дендримером AuNP-PAMAM.Дж. Люмин 204: 368–374. https://doi.org/10.1016/j.jlumin.2018.08.012

    CAS Статья Google ученый

  • 72.

    Lu Z, Chen X, Hu W (2017) Аптасенсор флуоресценции на основе полупроводниковых квантовых точек и нанолистов MoS2 для обнаружения охратоксина А. Датчики Актуаторы B Chem 246: 61–67. https://doi.org/10.1016/j.snb.2017.02.062

    CAS Статья Google ученый

  • 73.

    Qiu Z, Shu J, He Y et al (2017) Флуоресцентный аптасенсор на основе квантовых точек CdTe / CdSe с гемин / G-квадруплексным ДНКзимом для чувствительного обнаружения лизоцима с использованием амплификации по катящемуся кругу и гибридизации цепей. Биосенс ​​Биоэлектрон 87: 18–24. https://doi.org/10.1016/j.bios.2016.08.003

    CAS Статья PubMed Google ученый

  • 74.

    Lu Z, Chen X, Wang Y et al (2015) Анализ восстановления флуоресценции афлатоксина B1 на основе аптамера с использованием системы гашения, состоящей из квантовых точек и оксида графена.Microchim Acta 182: 571–578. https://doi.org/10.1007/s00604-014-1360-0

    CAS Статья Google ученый

  • 75.

    Xiang L, Tang J (2017) QD-аптамер в качестве донора для хемосенсора на основе FRET и оценка сродства между ацетамипридом и его аптамером. RSC Adv 7: 8332–8337. https://doi.org/10.1039/c6ra26118c

    CAS Статья Google ученый

  • 76.

    Li Y, Su R, Xu J et al (2018) Стратегия зондирования на основе аптамеров для 17? -Эстрадиола посредством передачи энергии резонанса флуоресценции между противоположно заряженными квантовыми точками CdTe и наночастицами золота. J Nanosci Nanotechnol 18: 1517–1527. https://doi.org/10.1166/jnn.2018.14235

    CAS Статья PubMed Google ученый

  • 77.

    Hu W, Chen Q, Li H et al (2016) Изготовление нового безметочного аптасенсора для ацетамиприда путем резонансного переноса энергии флуоресценции между NH 2 -NaYF 4: Yb, Ho @ SiO 2 и наночастицами Au.Biosens Bioelectron 80: 398–404. https://doi.org/10.1016/j.bios.2016.02.001

    CAS Статья PubMed Google ученый

  • 78.

    Tu L, Liu X, Wu F, Zhang H (2015) Динамика миграции энергии возбуждения в наноматериалах с повышенным преобразованием. Chem Soc Rev. 44: 1331–1345. https://doi.org/10.1039/c4cs00168k

    CAS Статья PubMed Google ученый

  • 79.

    Zhou B, Shi B, Jin D, Liu X (2015) Управление повышающим преобразованием нанокристаллов для новых приложений. Nat. Nanotechnol. 10: 924–936

    CAS Статья Google ученый

  • 80.

    Chen H, Guan Y, Wang S. et al (2014) Обнаружение включения маркера рака на основе передачи энергии люминесценции в ближнем инфракрасном диапазоне от NaYF 4 : Yb, Tm / NaGdF 4 Core –Оболочечное преобразование наночастиц в золотые наностержни. Langmuir 30: 13085–13091.https://doi.org/10.1021/la502753e

    CAS Статья PubMed Google ученый

  • 81.

    Li C, Zuo J, Li Q et al (2017) Одностадийный иммуноанализ цельной крови in situ на основе твердых субстратов, основанный на FRET между повышающим преобразованием и наночастицами золота. Biosens Bioelectron 92: 335–341. https://doi.org/10.1016/j.bios.2016.11.003

    CAS Статья PubMed Google ученый

  • 82.

    Чен Х, Юань Ф, Ван С. и др. (2013) Зондирование тромбина в красной области на основе аптамеров посредством резонансного переноса энергии флуоресценции между наночастицами NaYF4: Yb, Er с повышающим преобразованием и золотыми наностержнями. Биосенс ​​Биоэлектрон 48: 19–25. https://doi.org/10.1016/j.bios.2013.03.083

    CAS Статья PubMed Google ученый

  • 83.

    Hwang S-H, Im S-G, Sung H et al (2014) Резонансный перенос энергии Ферстера на основе наночастиц с повышающим преобразованием для обнаружения последовательности IS6110 комплекса Mycobacterium tuberculosis в мокроте.Biosens Bioelectron 53: 112–116. https://doi.org/10.1016/j.bios.2013.09.011

    CAS Статья PubMed Google ученый

  • 84.

    Вилела П., Эль-Сагир А., Миллар TM и др. (2017) Оптические сенсоры на основе наночастиц с повышающим преобразованием оксида графена для целевого обнаружения биомаркеров мРНК, присутствующих при болезни Альцгеймера и раке простаты. Датчики ACS 2: 52–56. https://doi.org/10.1021/acssensors.6b00651

    CAS Статья PubMed Google ученый

  • 85.

    Ye WW, Tsang M-K, Liu X et al (2014) Биосенсор на основе преобразования энергии люминесценции и резонанса (LRET) для быстрого и сверхчувствительного обнаружения вируса птичьего гриппа подтипа H7. Small 10: 2390–2397. https://doi.org/10.1002/smll.201303766

    CAS Статья PubMed Google ученый

  • 86.

    Long Q, Li H, Zhang Y, Yao S (2015) Анализ флуоресцентного резонансного переноса энергии на основе наночастиц с повышающим преобразованием для фосфорорганических пестицидов.Biosens Bioelectron 68: 168–174. https://doi.org/10.1016/j.bios.2014.12.046

    CAS Статья PubMed Google ученый

  • 87.

    Li H, Sun D, ​​Liu Y, Liu Z (2014) Сверхчувствительный гомогенный аптасенсор для канамицина, основанный на передаче резонансной энергии флуоресценции с повышением частоты преобразования. Biosens Bioelectron 55: 149–156. https://doi.org/10.1016/j.bios.2013.11.079

    CAS Статья PubMed Google ученый

  • 88.

    Cheng K, Zhang J, Zhang L et al (2017) Аптамерный биосенсор для обнаружения Salmonella typhimurium, основанный на передаче энергии люминесценции от легированного Mn 2+ NaYF 4: Yb, Tm, преобразующего наночастицы в золотые наностержни. Spectrochim Acta Часть A Mol Biomol Spectrosc 171: 168–173. https://doi.org/10.1016/j.saa.2016.08.012

    CAS Статья Google ученый

  • 89.

    Хао Т., Ву X, Сюй Л. и др. (2017) Сверхчувствительное обнаружение простатоспецифического антигена и тромбина на основе пирамид, собранных наночастицами с преобразованием золота.Маленький 13: 1603944. https://doi.org/10.1002/smll.201603944

    CAS Статья Google ученый

  • 90.

    Qu A, Wu X, Xu L et al (2017) Тримеры Au – Au – UCNP с активными SERS и люминесценцией для аттомолярного обнаружения двух биомаркеров рака. Наномасштаб 9: 3865–3872. https://doi.org/10.1039/C6NR09114H

    CAS Статья PubMed Google ученый

  • 91.

    Zhang H, Fang C, Wu S. et al (2015) Аптасенсор на основе резонансного переноса энергии люминесценции с повышением частоты преобразования для чувствительного обнаружения окситетрациклина. Анальная биохимия 489: 44–49. https://doi.org/10.1016/j.ab.2015.08.011

    CAS Статья PubMed Google ученый

  • 92.

    Liu Y, Ouyang Q, Li H et al (2018) Включение датчика флуоресценции для Hg 2+ в пищевых продуктах на основе FRET между наночастицами с аптамерным повышающим преобразованием и наночастицами золота.J. Agric Food Chem. 66: 6188–6195. https://doi.org/10.1021/acs.jafc.8b00546

    CAS Статья PubMed Google ученый

  • 93.

    Wang Y, Wei Z, Luo X et al (2019) Сверхчувствительный гомогенный аптасенсор для карциноэмбрионального антигена, основанный на передаче резонансной энергии флуоресценции с повышением конверсии. Таланта 195: 33–39. https://doi.org/10.1016/j.talanta.2018.11.011

    CAS Статья PubMed Google ученый

  • 94.

    Wu S, Duan N, Zhang H, Wang Z (2015) Одновременное обнаружение микроцизина-LR и окадаиновой кислоты с использованием аптасенсора с двойным флуоресцентным резонансным переносом энергии. Anal Bioanal Chem. 407: 1303–1312. https://doi.org/10.1007/s00216-014-8378-3

    CAS Статья PubMed Google ученый

  • 95.

    Wu Z, Xu E, Jin Z, Irudayaraj J (2018) Сверхчувствительный аптасенсор, основанный на флуоресцентной резонансной передаче энергии и рециклинге мишеней с помощью экзонуклеаз для обнаружения патулина.Food Chem 249: 136–142. https://doi.org/10.1016/j.foodchem.2018.01.025

    CAS Статья PubMed Google ученый

  • 96.

    Li H, Shi L, en SD et al (2016) Биосенсор с резонансным флуоресцентным переносом энергии между наночастицами с повышающим преобразованием и наночастицами палладия для сверхчувствительного обнаружения CEA. Biosens Bioelectron 86: 791–798. https://doi.org/10.1016/j.bios.2016.07.070

    CAS Статья PubMed Google ученый

  • 97.

    Dai S, Wu S, Duan N, Wang Z (2016) Аптасенсор на основе резонансного переноса энергии люминесценции для микотоксина охратоксина A с использованием наночастиц повышающего преобразования и золотых наностержней. Microchim Acta 183: 1909–1916. https://doi.org/10.1007/s00604-016-1820-9

    CAS Статья Google ученый

  • 98.

    Смит Н.М., Амран С., Розу Ф. и др. (2012) Взаимодействие ртути и тимина с архитектурой G-квадруплекса кресельного типа.Chem Commun 48: 11464. https://doi.org/10.1039/c2cc36481f

    CAS Статья Google ученый

  • 99.

    Büning-Pfaue H (2003) Анализ воды в пищевых продуктах методом ближней инфракрасной спектроскопии. Food Chem 82: 107–115. https://doi.org/10.1016/S0308-8146(02)00583-6

    CAS Статья Google ученый

  • 100.

    Kong L, Li Y, Ma C et al (2018) Чувствительный иммуноанализ фактора фон Виллебранда, основанный на резонансном переносе энергии флуоресценции между квантовыми точками графена и наночастицами Ag @ Au.Коллоидные поверхности B Биоинтерфейсы 165: 286–292. https://doi.org/10.1016/j.colsurfb.2018.02.049

    CAS Статья PubMed Google ученый

  • 101.

    Gao X, Zhang B, Zhang Q et al (2018) Влияние комбинированного режима на структуру и свойства композитов графеновых квантовых точек и порфиринов. Коллоидные поверхности B Биоинтерфейсы 172: 207–212. https://doi.org/10.1016/j.colsurfb.2018.08.010

    CAS Статья PubMed Google ученый

  • 102.

    He Y, Wen X, Zhang B, Fan Z (2018) Новый аптасенсор для сверхчувствительного обнаружения канамицина на основе одноцепочечного ДНК-связывающего белка с квантовыми точками графеноксида. Датчики-приводы, B Chem 265: 20–26. https://doi.org/10.1016/j.snb.2018.03.029

    CAS Статья Google ученый

  • 103.

    Шен Дж., Чжу Й., Ян Х, Ли С. (2012) Графеновые квантовые точки: возникающие нанолайки для биоимиджинга, сенсоров, катализа и фотоэлектрических устройств.Chem Commun 48: 3686. https://doi.org/10.1039/c2cc00110a

    CAS Статья Google ученый

  • 104.

    Shi J, Chan C, Pang Y et al (2015) Биосенсор флуоресцентного резонансного переноса энергии (FRET) на основе квантовых точек графена (GQD) и наночастиц золота (AuNP) для обнаружения последовательности гена mecA Золотистый стафилококк. Biosens Bioelectron 67: 595–600. https://doi.org/10.1016/j.bios.2014.09.059

    CAS Статья PubMed Google ученый

  • 105.

    Шен Дж, Чжу Й, Ян Х и др. (2012) Гидротермальный синтез графенеквантовых точек, поверхность которых пассивирован полиэтиленгликолем, и их фотоэлектрическое преобразование в ближнем инфракрасном диапазоне. New J Chem 36: 97–101. https://doi.org/10.1039/C1NJ20658C

    CAS Статья Google ученый

  • 106.

    Shi J, Lyu J, Tian F, Yang M (2017) Биосенсор включения флуоресценции на основе графеновых квантовых точек (GQD) и нанолистов дисульфида молибдена (MoS2) для обнаружения молекул адгезии эпителиальных клеток (EpCAM). Biosens Bioelectron 93: 182–188. https://doi.org/10.1016/j.bios.2016.09.012

    CAS Статья PubMed Google ученый

  • 107.

    Пфайфер Ф., Майер Дж. (2016) Выбор и биосенсорное применение аптамеров для малых молекул.Front Chem 4 (25). https://doi.org/10.3389/fchem.2016.00025

  • 108.

    Pfohl-Leszkowicz A, Manderville RA (2007) Охратоксин A: Обзор токсичности и канцерогенности для животных и людей. Mol Nutr Food Res 51: 61–99. https://doi.org/10.1002/mnfr.200600137

    Артикул PubMed Google ученый

  • 109.

    Cao L-H, Li H-Y, Xu H et al (2017) Разнообразные структурные превращения растворения-рекристаллизации и последовательное поведение резонансного переноса энергии Фёрстера люминесцентным пористым Cd-MOF.Дальт Транс, 46: 11656–11663. https://doi.org/10.1039/C7DT02697H

    CAS Статья Google ученый

  • 110.

    Тиан Дж., Вэй В., Ван Дж и др. (2018) Аптасенсор флуоресцентного резонансного переноса энергии между наноцериями и квантовыми точками графена для определения охратоксина A. Anal Chim Acta 1000: 265–272. https://doi.org/10.1016/j.aca.2017.08.018

    CAS Статья PubMed Google ученый

  • 111.

    Cheng X, Cen Y, Xu G et al (2018) Флуорометрическое определение АТФ на основе аптамера с использованием FRET между углеродными точками и оксидом графена. Microchim Acta 185 (144). https://doi.org/10.1007/s00604-018-2683-z

  • 112.

    Wu X, Song Y, Yan X et al (2017) Квантовые точки углерода как датчики флуоресцентного резонансного переноса энергии для определения фосфорорганических пестицидов. Biosens Bioelectron 94: 292–297. https://doi.org/10.1016/j.bios.2017.03.010

    CAS Статья PubMed Google ученый

  • 113.

    Mohammadi S, Salimi A, Hamd-Ghadareh S et al (2018) Иммуносенсор FRET для чувствительного обнаружения онкомаркера CA 15-3 в образце сыворотки человека и клетках рака молочной железы с использованием функционализированных антителами люминесцентных углеродных точек и аптамера AuNPs-дендример в качестве донорно-акцепторная пара. Анальная биохимия 557: 18–26. https://doi.org/10.1016/j.ab.2018.06.008

    CAS Статья PubMed Google ученый

  • 114.

    Zhu S, Song Y, Zhao X et al (2015) Механизм фотолюминесценции в углеродных точках (графеновые квантовые точки, углеродные наноточки и полимерные точки): текущее состояние и перспективы на будущее.Nano Res 8: 355–381

    CAS Статья Google ученый

  • 115.

    Wang X, Xu G, Wei F et al (2017) Высокочувствительный и селективный аптасенсор для обнаружения аденозина на основе резонансного переноса энергии флуоресценции от углеродных точек на нанографит. J Colloid Interface Sci 508: 455–461. https://doi.org/10.1016/j.jcis.2017.07.028

    CAS Статья PubMed Google ученый

  • 116.

    Zhao Q, Zhou C, Yang Q et al (2019) Флуоресцентный зонд на основе FRET для перекиси водорода, основанный на использовании квантовых точек углерода, конъюгированных с нанокластерами золота. Microchim Acta 186 (294). https://doi.org/10.1007/s00604-019-3398-5

  • 117.

    Qian ZS, Shan XY, Chai LJ et al (2015) Флуоресцентный наносенсор на основе графеновых квантовых точек — аптамерный зонд и платформа из оксида графена для обнаружения иона свинца (II). Biosens Bioelectron 68: 225–231. https: // doi.org / 10.1016 / j.bios.2014.12.057

    CAS Статья PubMed Google ученый

  • 118.

    Saberi Z, Rezaei B, Faroukhpour H, Ensafi AA (2018) Флуорометрический аптасенсор для метамфетамина на основе флуоресцентного резонансного переноса энергии с использованием нанолистов оксигидроксида кобальта и углеродных точек. Microchim Acta 185: 303. https://doi.org/10.1007/s00604-018-2842-2

    CAS Статья Google ученый

  • 119.

    Shen X, Xu L, Zhu W et al (2017) Включающий флуоресцентный аптасенсор на основе углеродных точек для чувствительного обнаружения аденозина. New J Chem 41: 9230–9235. https://doi.org/10.1039/C7NJ02384G

    CAS Статья Google ученый

  • 120.

    Xu M, Gao Z, Zhou Q et al (2016) Углеродные точки, координированные с ионами тербия, для флуоресцентного аптасенсинга аденозин-5′-трифосфата немодифицированными наночастицами золота. Biosens Bioelectron 86: 978–984.https://doi.org/10.1016/j.bios.2016.07.105

    CAS Статья PubMed Google ученый

  • 121.

    Zhu L, Xu G, Song Q et al (2016) Высокочувствительное определение дофамина с помощью включаемого флуоресцентного биосенсора на основе углеродных точек, меченных аптамером, и нанографита. Датчики Актуаторы B Chem 231: 506–512. https://doi.org/10.1016/j.snb.2016.03.084

    CAS Статья Google ученый

  • 122.

    Ван Б., Чен И, Ву И и др. (2016) Аптамер индуцировал сборку флуоресцентных углеродных точек, допированных азотом, на наночастицах золота для чувствительного обнаружения AFB 1. Biosens Bioelectron 78: 23–30. https://doi.org/10.1016/j.bios.2015.11.015

    CAS Статья PubMed Google ученый

  • 123.

    Ван И, Ма Т., Ма С. и др. (2017) Флуорометрическое определение антибиотика канамицина путем индуцированного аптамером тушения FRET и восстановления между нанолистами MoS2 и углеродными точками.Microchim Acta 184: 203–210. https://doi.org/10.1007/s00604-016-2011-4

    CAS Статья Google ученый

  • 124.

    Zhu X, Zheng H, Wei X et al (2013) Металлоорганический каркас (MOF): новая сенсорная платформа для биомолекул. Chem Commun 49: 1276. https://doi.org/10.1039/c2cc36661d

    CAS Статья Google ученый

  • 125.

    McKinlay AC, Morris RE, Horcajada P et al (2010) BioMOFs: металл-органические основы для биологических и медицинских приложений. Angew Chemie Int Ed 49: 6260–6266. https://doi.org/10.1002/anie.201000048

    CAS Статья Google ученый

  • 126.

    Ma D, Wang W, Li Y et al (2010) Синтез 2,5-пиразиндикарбоксилатных и оксалатных лигандов in situ, приводящий к микропористому органическому каркасу европия, способному избирательно воспринимать небольшие молекулы.CrystEngComm 12: 4372. https://doi.org/10.1039/c0ce00135j

    CAS Статья Google ученый

  • 127.

    Qu F, Sun C, Lv X, You J (2018) Металлоорганический каркас на основе тербия и система наночастиц золота в качестве флуорометрического зонда для определения аденозинтрифосфата на основе аптамера. Микрохим Акта 185: 359. https://doi.org/10.1007/s00604-018-2888-1

    CAS Статья PubMed Google ученый

  • 128.

    Ли Дж., Ким Дж., Ким С., Мин Д.Х. (2016) Биосенсоры на основе оксида графена и их биомедицинское применение. Adv. Препарат Делив. Ред. 105: 275–287

    CAS Статья Google ученый

  • 129.

    Zou W, Gong F, Gu T et al (2018) Эффективная стратегия определения пирофосфата на основе богатых азотом квантовых точек в сочетании с оксидом графена. Microchem J 141: 466–472. https://doi.org/10.1016/j.microc.2018.06.004

    CAS Статья Google ученый

  • 130.

    Dhiman A, Kalra P, Bansal V et al (2017) Диагностические платформы для точек оказания помощи на основе аптамеров. Датчики Актуаторы, B Chem. 246: 535–553

    CAS Статья Google ученый

  • 131.

    Lee J, Samson AAS, Yim Y et al (2019) Анализ FRET для количественного определения ингибиторов экзонуклеазы EcoRV с использованием пергаментной бумаги, напечатанной струйной печатью с оксидом графена и ДНК, меченной FAM. Microchim Acta 186 (211). https://doi.org/10.1007/s00604-019-3317-9

  • 132.

    Алонсо-Кристобаль П., Вилела П., Эль-Сагир А. и др. (2015) Высокочувствительный датчик ДНК на основе наночастиц с повышающим преобразованием и оксида графена. Интерфейсы приложения ACS Mater 7: 12422–12429. https://doi.org/10.1021/am507591u

    CAS Статья PubMed Google ученый

  • 133.

    Фурукава К., Уэно Ю., Такамура М., Хибино Х. (2016) Graphene FRET Aptasensor. Датчики ACS 1: 710–716. https://doi.org/10.1021/acssensors.6b00191

    CAS Статья Google ученый

  • 134.

    Tian F, Lyu J, Shi J, Yang M (2017) Анализы флуоресцентного резонансного переноса энергии (FRET) на основе графена и графеноподобных материалов двух наименований для биологических применений. Биосенс ​​Биоэлектрон 89: 123–135. https://doi.org/10.1016/j.bios.2016.06.046

    CAS Статья PubMed Google ученый

  • 135.

    Гарсия-Каньяс В., Симо С., Эрреро М. и др. (2012) Настоящие и будущие проблемы анализа пищевых продуктов: Foodomics. Anal Chem 84: 10150-10159. https://doi.org/10.1021/ac301680q

    CAS Статья PubMed Google ученый

  • 136.

    Арнольд С.М., Кларк К.Э., Стейплс К.А. и др. (2013) Актуальность питьевой воды как источника воздействия бисфенола на человека A. J Expo Sci Environ Epidemiol 23: 137–144. https: // doi.org / 10.1038 / jes.2012.66

    CAS Статья PubMed Google ученый

  • 137.

    Zhu Y, Cai Y, Xu L et al (2015) Создание FRET биосенсора аптамер / оксид графена для одноэтапного обнаружения бисфенола A. Интерфейсы ACS Appl Mater 7: 7492–7496. https://doi.org/10.1021/acsami.5b00199

    CAS Статья PubMed Google ученый

  • 138.

    Zhang H, Zhang H, Aldalbahi A et al (2017) Флуоресцентные биосенсоры на основе графена и оксида графена. Биосенс ​​Биоэлектрон 89: 96–106. https://doi.org/10.1016/j.bios.2016.07.030

    CAS Статья PubMed Google ученый

  • 139.

    Zhou ZM, Zhou J, Chen J et al (2014) Обнаружение карцино-эмбрионального антигена на основе флуоресцентного резонансного переноса энергии между квантовыми точками и оксидом графена.Biosens Bioelectron 59: 397–403. https://doi.org/10.1016/j.bios.2014.04.002

    CAS Статья PubMed Google ученый

  • 140.

    Kenry GA, Zhang X et al (2016) Высокочувствительное и селективное флуоресцентное определение малярийного биомаркера на основе аптамеров с использованием однослойных MoS2Nanosheets. Датчики ACS 1: 1315–1321. https://doi.org/10.1021/acssensors.6b00449

    CAS Статья Google ученый

  • 141.

    Сингх П., Гупта Р., Синха М. и др. (2016) Платформа цифрового ответа на основе MoS2 для флуоресцентного обнаружения патогенов на основе аптамера. Microchim Acta 183: 1501–1506. https://doi.org/10.1007/s00604-016-1762-2

    CAS Статья Google ученый

  • 142.

    Yuan Y, Li R, Liu Z (2014) Создание водорастворимого слоистого нанолиста WS 2 в качестве платформы для биосенсинга. Anal Chem 86: 3610–3615. https: // doi.org / 10.1021 / ac5002096

    CAS Статья PubMed Google ученый

  • 143.

    Zhang Y, Zheng B, Zhu C et al (2015) Наносенсоры на основе однослойных дихалькогенидов переходных металлов на основе нанолистов для быстрого, чувствительного и мультиплексного обнаружения ДНК. Adv Mater 27: 935–939. https://doi.org/10.1002/adma.201404568

    CAS Статья PubMed Google ученый

  • 144.

    Ge J, Ou E-C, Yu R-Q, Chu X (2014) Новый аптамерный нанобиосенсор, основанный на архитектуре самособирающихся нанолистов ДНК-MoS 2 для обнаружения биомолекул. J Mater Chem B 2: 625–628. https://doi.org/10.1039/C3TB21570A

    CAS Статья PubMed Google ученый

  • 145.

    Cui F, Ji J, Sun J et al (2019) Новый магнитно-флуоресцентный биосенсор на основе графеновых квантовых точек для быстрого, эффективного и чувствительного разделения и обнаружения циркулирующих опухолевых клеток.Anal Bioanal Chem 411: 985–995. https://doi.org/10.1007/s00216-018-1501-0

    CAS Статья PubMed Google ученый

  • 146.

    Gao L, Li Q, Deng Z et al (2017) Высокочувствительное определение белка с помощью ковалентно связанного аптамера с MoS2 и стратегии амплификации с помощью экзонуклеаз. Int J Nanomedicine 12: 7847–7853. https://doi.org/10.2147/IJN.S145585

    CAS Статья PubMed PubMed Central Google ученый

  • 147.

    Jia L, Ding L, Tian J et al (2015) Нанопластинки MoS 2, загруженные аптамером, в качестве нанозондов для обнаружения внутриклеточного АТФ и контролируемой фотодинамической терапии. Наномасштаб 7: 15953–15961. https://doi.org/10.1039/C5NR02224J

    CAS Статья PubMed Google ученый

  • 148.

    Равикумар А., Паннеерсельвам П., Радхакришнан К. и др. (2018) Нанолисты MoS 2 в качестве эффективного флуоресцентного тушителя для последовательного обнаружения ионов мышьяка в водной системе.Appl Surf Sci 449: 31–38. https://doi.org/10.1016/j.apsusc.2017.12.098

    CAS Статья Google ученый

  • 149.

    Xu S, Feng X, Gao T et al (2017) Аптамер индуцировал разноцветный Au NCs-MoS 2 «включающий» флуоресцентный биосенсор с резонансным переносом энергии для двухцветного одновременного обнаружения множества опухолевых маркеров с помощью возбуждения на одной длине волны. Анальный Чим Acta 983: 173–180. https://doi.org/10.1016/j.aca.2017.06.023

    CAS Статья PubMed Google ученый

  • 150.

    Chen J, Li Y, Huang Y et al (2019) Флуорометрический анализ дофамина, основанный на системе передачи энергии, состоящей из квантовых точек MoS2, функционализированных аптамером, и нанолистов MoS2. Microchim Acta 186 (58). https://doi.org/10.1007/s00604-018-3143-5

  • 151.

    Эстебан-Фернандес де Авила Б., Лопес-Рамирес М.А., Баес Д.Ф. и др. (2016) Каталитические микродвигатели на основе графена, модифицированные аптамером: флуоресцентное обнаружение рицина выключено.Датчики ACS 1: 217–221. https://doi.org/10.1021/acssensors.5b00300

    CAS Статья Google ученый

  • 152.

    Guo H, Li J, Li Y et al (2018) Включаемый флуоресцентный датчик для обнаружения Hg 2+ на основе оксида графена и аптамеров ДНК. New J Chem 42: 11147–11152. https://doi.org/10.1039/C8NJ01709C

    CAS Статья Google ученый

  • 153.

    Zhang J, Li Z, Zhao S, Lu Y (2016) Зависимая от размера модуляция взаимодействий оксид графена с аптамером для детектирования афлатоксина B 1 на основе усиленной флуоресценции с настраиваемым динамическим диапазоном. Аналитик 141: 4029–4034. https://doi.org/10.1039/C6AN00368K

    CAS Статья PubMed Google ученый

  • 154.

    Qin J, Cui X, Wu P et al (2017) Анализ флуоресцентного сенсора на β-лактамазу в молоке на основе комбинации аптамера и оксида графена.Food Control 73: 726–733. https://doi.org/10.1016/j.foodcont.2016.09.023

    CAS Статья Google ученый

  • 155.

    Ha N, Jung I-P, La I et al (2017) Сверхчувствительное обнаружение канамицина для обеспечения безопасности пищевых продуктов с использованием флуоресцентного аптасенсора на основе восстановленного оксида графена. Sci Rep 7 (40305). https://doi.org/10.1038/srep40305

  • 156.

    Weng X, Neethirajan S (2016) Микрожидкостный биосенсор, использующий оксид графена и функционализированные аптамером квантовые точки для обнаружения аллергена арахиса.Biosens Bioelectron 85: 649–656. https://doi.org/10.1016/j.bios.2016.05.072

    CAS Статья PubMed Google ученый

  • 157.

    Sui N, Wang L, Xie F et al (2016) Сверхчувствительный анализ тромбина на основе аптамеров, основанный на усиленной металлом резонансной передаче энергии флуоресценции. Microchim Acta 183: 1563–1570. https://doi.org/10.1007/s00604-016-1774-y

    CAS Статья Google ученый

  • 158.

    Persson BNJ, Lang ND (1982) Электронно-дырочное тушение возбужденных состояний вблизи металла. Phys Rev B 26: 5409–5415. https://doi.org/10.1103/PhysRevB.26.5409

    CAS Статья Google ученый

  • 159.

    Chen C, Midelet C, Bhuckory S. et al (2018) Наноповерхностная передача энергии от долгоживущих доноров тербия к золотым наночастицам. J. Phys Chem. C 122: 17566–17574. https://doi.org/10.1021/acs.jpcc.8b06539

    CAS Статья Google ученый

  • 160.

    Дженнингс Т.Л., Сингх М.П., ​​Страус Г.Ф. (2006) Флуоресцентное гашение на время жизни вблизи d = 1,5 нм Наночастицы золота: проверка достоверности NSET. J Am Chem Soc 128: 5462–5467. https://doi.org/10.1021/ja0583665

    CAS Статья PubMed Google ученый

  • 161.

    Li G, Zeng J, Liu H et al (2019) Флуорометрический аптамерный нанозонд для альфа-фетопротеина, использующий FRET между 5-карбоксифлуоресцеином и наночастицами палладия.Microchim Acta 186 (314). https://doi.org/10.1007/s00604-019-3403-z

  • 162.

    Holzinger M, Le Goff A, Cosnier S (2014) Наноматериалы для биосенсорных приложений: обзор. Front Chem 2: 1–10. https://doi.org/10.3389/fchem.2014.00063

    CAS Статья Google ученый

  • 163.

    Abouna GM (2004) Использование маргинальных-субоптимальных донорских органов: практическое решение проблемы нехватки органов.Энн Трансплант 9: 62–66. https://doi.org/10.1021/cm020732l

  • 164.

    Юань Ф., Чен Х., Сюй Дж и др. (2014) Передача энергии люминесценции на основе аптамеров от ближней инфракрасной области к ближней инфракрасной, повышающей преобразование наночастиц в золотые наностержни, и его применение для обнаружения тромбина. Chem — A Eur J 20: 2888–2894. https://doi.org/10.1002/chem.201304556

    CAS Статья Google ученый

  • 165.

    Xing H, Wei T, Lin X, Dai Z (2018) MnCuInS / ZnS @ BSA в ближнем инфракрасном диапазоне и наночастица Au, подобная ежу, в качестве новой донорно-акцепторной пары для улучшенного биосенсинга FRET. Анальный Чим Acta 1042: 71–78. https://doi.org/10.1016/j.aca.2018.05.048

    CAS Статья PubMed Google ученый

  • 166.

    Zhang R, Sun J, Ji J et al (2019) Новый биосенсор OFF-ON, основанный на наноповерхностной передаче энергии между золотыми нанокрестами и графеновыми квантовыми точками для внутриклеточного зондирования и отслеживания АТФ.Датчики-приводы, B Chem 282: 910–916. https://doi.org/10.1016/j.snb.2018.11.141

    CAS Статья Google ученый

  • 167.

    Qaddare SH, Salimi A (2017) Усиленное флуоресцентное зондирование ДНК с использованием люминесцентных углеродных точек и AuNP / GO в качестве сенсорной платформы: новое сочетание FRET и гибридизации ДНК для обнаружения гомогенного гена ВИЧ-1 на фемтомолярном уровне . Biosens Bioelectron 89: 773–780. https: // doi.org / 10.1016 / j.bios.2016.10.033

    CAS Статья PubMed Google ученый

  • 168.

    Wang Y, Gan N, Zhou Y et al (2017) Новый переключатель флуоресцентного аптамера с одноцепочечным ДНК-связывающим белком на основе FRET для гомогенного обнаружения антибиотиков. Biosens Bioelectron 87: 508–513. https://doi.org/10.1016/j.bios.2016.08.107

    CAS Статья PubMed Google ученый

  • 169.

    Yu M, Wang H, Fu F et al (2017) Платформа на основе резонансной передачи энергии Фёрстера с двойным распознаванием для одноэтапного чувствительного обнаружения патогенных бактерий с использованием флуоресцентных нанокластеров ванкомицин-золото и наночастиц аптамер-золото. Anal Chem 89: 4085-4090. https://doi.org/10.1021/acs.analchem.6b04958

    CAS Статья PubMed Google ученый

  • 170.

    Han Z, Chen L, Weng Q et al (2018) Покрытый кремнеземом золотой наностержень @ CdSeTe структура ядра / оболочки тройных квантовых точек для обнаружения флуоресценции и двухмодальной визуализации.Датчики Актуаторы B Chem 258: 508–516. https://doi.org/10.1016/j.snb.2017.11.157

    CAS Статья Google ученый

  • 171.

    Ye T, Peng Y, Yuan M et al (2019) «включающий» флуорометрический анализ для обнаружения канамицина с использованием нанокластеров серебра и передачи энергии, усиленной поверхностным плазмоном. Microchim Acta 186 (40). https://doi.org/10.1007/s00604-018-3161-3

  • 172.

    Léger C, Di Meo T, Aumont-Nicaise M et al (2019) Индуцированный лигандом конформационный переключатель в искусственном каркасе бидоменного белка. Sci Rep 9 (1178). https://doi.org/10.1038/s41598-018-37256-5

  • 173.

    Wu Y-T, Qiu X, Lindbo S. et al (2018) Квантово-точечный иммуноферментный анализ FRET для HER2 с использованием сверхмалых аффинных белков. Маленький 14: 1802266. https://doi.org/10.1002/smll.201802266

    CAS Статья Google ученый

  • Молекулярный маяк CRISPR / dual-FRET для чувствительной визуализации живых клеток неповторяющихся локусов генома | Исследование нуклеиновых кислот

    Аннотация

    Кластерные системы геномной визуализации на основе регулярных промежуточных коротких палиндромных повторов (CRISPR) в основном полагаются на флуоресцентные белковые репортеры, у которых отсутствуют оптические свойства, необходимые для чувствительной динамической визуализации.Здесь мы модифицировали однонаправленную РНК CRISPR (sgRNA), чтобы нести два различных молекулярных маяка (MB), которые могут подвергаться флуоресцентному резонансному переносу энергии (FRET), и продемонстрировали, что полученная система CRISPR / dual-FRET MB позволяет динамическое отображение неповторяющиеся геномные локусы всего с тремя уникальными sgRNA.

    ВВЕДЕНИЕ

    Деактивированный нуклеазой мутант кластерного белка 9, ассоциированного с короткими палиндромными повторами (CRISPR) с регулярными интервалами (CRISPR), сохраняет способность связываться с конкретным целевым геномным локусом посредством ассоциации с родственной Cas9 однонаправленной РНК (sgRNA), тем самым стимулируя разработка основанных на CRISPR подходов для неинвазивной геномной визуализации (1–10).Однако в большинстве подходов используются dCas9 или sgRNA, модифицированные для переноса флуоресцентных белков (FP), которым не хватает яркости и фотостабильности, необходимых для непрерывной визуализации. Органические красители (флуорофоры), по сравнению с ФП, обычно более яркие и светостойкие. Кроме того, флуоресценция многих флуорофоров может быть значительно снижена, если они расположены в непосредственной близости от совместимого гасителя. Соответственно, были разработаны различные флуорогенные зонды на основе пар флуорофор-гаситель, чтобы сделать возможным обнаружение конкретных биомолекул в живых клетках без необходимости смывать несвязанные зонды.Одним из широко используемых флуорогенных зондов является молекулярный маяк (MB) (11), класс олигонуклеотидных зондов, образующих петлю и стволовых, содержащих флуорофор и гаситель на двух концах, который широко использовался для визуализации РНК живых клеток (12–12). 14). Перед активацией МБ проявляют слабый сигнал флуоресценции, поскольку комплементарные последовательности коротких плеч на двух концах самоотжигаются с образованием стабильного дуплекса ствола, который удерживает флуорофор и гаситель в непосредственной близости. Гибридизация РНК-мишени с доменом петли разрушает дуплекс ствола, что приводит к отделению гасителя от флуорофора для восстановления флуоресценции MB.

    Признавая полезность sgRNA для геномного мечения и полезные флуорогенные свойства MB при гибридизации РНК, наша лаборатория недавно объединила системы CRISPR и MB для создания платформы для визуализации генома под названием CRISPR / MB (9), которая состоит из dCas9, MB и sgRNA, сконструированные так, чтобы нести уникальную целевую последовательность MB, не обнаруженную в геноме человека (MTS). Чтобы осветить конкретный геномный локус, dCas9 и модифицированная sgRNA сначала совместно экспрессируются для нацеливания на локус в клетках, после чего следует доставка MB, которые после гибридизации с MTS могут освещать целевой локус.Посредством визуализации повторяющихся элементов внутри теломер мы продемонстрировали, что CRISPR / MB более эффективен и чувствителен, чем традиционные подходы, использующие белки, связывающие повторы теломер, слитые с FP. В этом исследовании мы стремились дополнительно усовершенствовать систему CRISPR / MB путем модификации sgRNA, чтобы она содержала две различные целевые последовательности MB (sgRNA_dual-MTS) для двух разных MB, флуорофоры которых образуют пару флуоресцентного резонансного переноса энергии (FRET) (рисунок 1) , стратегия, названная MB с двойным FRET (15,16).Поскольку FRET возникает только тогда, когда два MB гибридизуются с одной и той же РНК, предполагается, что MB с двойным FRET избегают фоновых сигналов, возникающих в результате несовершенного тушения и неспецифического связывания с белками отдельных MB. Были проведены конкретные эксперименты для оценки возможностей предлагаемой нами системы, названной CRISPR / dual-FRET MB, для визуализации живых клеток неповторяющихся областей в геномных локусах с использованием широкопольной флуоресцентной микроскопии.

    Рисунок 1.

    Схема MB CRISPR / dual-FRET для маркировки определенного локуса.Чтобы осветить конкретный геномный локус, сначала коэкспрессировали dCas9 и sgRNA_dual-MTS для нацеливания на локус в клетках. За этим следует доставка как донорных, так и акцепторных MB (MB с двойным FRET), что после гибридизации с одним и тем же двойным MTS может приводить к тому, что FRET освещает целевой локус.

    Рисунок 1.

    Схема MB CRISPR / dual-FRET для маркировки определенного локуса. Чтобы осветить конкретный геномный локус, сначала коэкспрессировали dCas9 и sgRNA_dual-MTS для нацеливания на локус в клетках.За этим следует доставка как донорных, так и акцепторных MB (MB с двойным FRET), что после гибридизации с одним и тем же двойным MTS может приводить к тому, что FRET освещает целевой локус.

    МАТЕРИАЛЫ И МЕТОДЫ

    Клонирование экспрессионных конструкций dCas9

    Для генерации BFP / dCas9-C1, который кодирует BFP (контроль трансфекции) и дезактивированный нуклеазой Streptococcus pyogenes Cas9 (dCas9) под контролем отдельных промоторов, sgRNA, нацеленная на теломеры (sgTelo), была удалена из sgTelo / BFP. / dCas9-C1, описанный ранее (9) с использованием AseI, с последующим самолигированием полученного вектора.Для создания pCMV-dCas9-EGFP-C1, который кодирует dCas9, слитый с EGFP (dCas9-EGFP), кодирующая область dCas9-EGFP была сначала амплифицирована с помощью ПЦР из pSLQ1658-dCas9-EGFP (плазмида Addgene № 51023) (4) с использованием прямого праймер 5′-GCTACCGGTCGCCACCATGGTGCCCAAAAAGAAGAGGAAAGTGGACAAGA-3 ‘и обратный праймер 5′-GTAGAATTCTTACTTGTACAGCTCGTCCATGCCGAG-3’. Затем продукт ПЦР вставляли в вектор pmTagBFP2-C1 (подарок от Prabuddha Sengupta, Janelia Research Campus, США), расщепленный AgeI и EcoRI, чтобы вырезать mTagBFP2.

    Клонирование конструкций экспрессии sgRNA

    Для маркировки неповторяющихся областей

    Плазмида, несущая кассету U6-sgRNA_dual-MTS, была изготовлена ​​на заказ Пекинским институтом геномики (Пекин, Китай) и использовалась для создания плазмиды остова для каждой sgRNA, нацеленной на неповторяющуюся область. В частности, спейсерная последовательность sgRNA_dual-MTS была заменена спейсерной последовательностью, разработанной для гибридизации с уникальной областью внутри локуса MUC4, MUC1 или IGR или бессмысленной спейсерной последовательностью (контроль) посредством ПЦР-опосредованной сайт-направленной мутагенез (см. дополнительную таблицу S1 для информации о каркасах sgRNA, дополнительную таблицу S2 для информации о спейсере / области-мишени и дополнительную таблицу S3 для информации о праймерах).После этого продукт ПЦР кассеты U6-sgRNA_dual-MTS из каждой плазмиды остова (Прямой праймер: 5′-ACTGCTGTCGACAATGCGTCGAGATCCAATTAGTTAT-3 ‘; обратный праймер: 5’-ACCTGCGATGATCCCTCGAGTGATAGACTGACCTCGAGTGATAGACACCTCGAGTGATAGACAz) был вставлен в pz вектор, расщепленный с помощью SalI и BamHI, для создания конструкции экспрессии sgRNA для каждой sgRNA. Из полученных конструкций был создан набор мультиплексированных экспрессионных конструкций sgRNA, содержащих различное количество уникальных кассет U6-sgRNA_dual-MTS (см. Дополнительную таблицу S4) с использованием протокола, описанного ранее van den Bogaard и Tyagi (17).Для MUC4 была также создана конструкция мультиплексной экспрессии sgRNA, кодирующая три уникальных sgRNA, лишенных двойной MTS (sgMUC4) с теми же спейсерами, что и 3 sgMUC4_dual-MTS набора I (см. Дополнительную таблицу S1, таблицу S2 и таблицу S4). с использованием того же протокола с родительскими конструкциями, полученными с помощью ПЦР-опосредованного сайт-направленного мутагенеза для удаления двойной-MTS и дополнительных последовательностей, фланкирующих двойную-MTS, с использованием прямого праймера 5′-GAAAAAGTGGCACCGAGTCGGTGCTTT-3 ‘и обратного праймера 5’-AAGTTGATAACGGACTAGCCTT- 3 ′.

    Для маркировки повторяющихся областей

    Для создания pSLQ1661-sgMUC4-E3 (F + E) / BFP, конструкции, которая кодирует немодифицированную sgRNA (без двойной MTS) со спейсерной последовательностью, комплементарной повторяющейся последовательности, проксимальной к неповторяющимся областям MUC4 ген ( MUC4 -NRR), как описано выше (sgRNA-rep (Proximal to MUC4 -NRR), см. дополнительную таблицу S1 и таблицу S5), mTagBFP2 амплифицировали с помощью ПЦР из вектора pmTagBFP2-C1 с использованием прямого праймера 5′- AGCGCTACCGGTCGCCACCATG-3 ‘и обратный праймер 5′-ACTGCAGAATTCTTAATTAAGCTTGTGCCCCAGTTTGC-3’, а затем вставленный в pSLQ1661-sgMUC4-E3 (F + E) (плазмида Addgene № 51025) (4) расщеплена с помощью EcoRI, чтобы удалить с помощью AgeI эксцизию (4) и расщепить mCherry с помощью AgeI.Для создания конструкций, которые кодируют sgRNAs, нацеленные на другие повторяющиеся области (см. Дополнительную таблицу S5), кассету U6-sgMUC4-E3 (F + E) pSLQ1661-sgMUC4-E3 (F + E) / BFP сначала амплифицировали с использованием прямого праймера 5. ‘-ACTGCTGTCGACTTTGGTTAGTACCGGGCCCGCTCTA-3′ и обратный праймер 5’-CTAATGGATCCTAGTACTCGAGAAA-3 ‘с последующим субклонированием продукта ПЦР в вектор pGEM-11zf (+), расщепленный SalI и BamHI. Последовательность спейсера в векторе субклонирования заменяли спейсером каждой sgRNA посредством PCR-опосредованного сайт-направленного мутагенеза (информацию о праймерах см. В дополнительной таблице S6).Область, которая содержит кассету U6-sgRNA в полученной плазмиде, затем была клонирована обратно в pSLQ1661-sgMUC4-E3 (F + E) / BFP, расщепленная XbaI и BamHI, чтобы вырезать кассету U6-sgMUC4-E3 (F + E). .

    Синтез МБ

    Донорский МБ был помечен гасителем Iowa Black FQ на 5′-конце и флуорофором ATTO550 на 3′-конце и имел последовательность: 5′-mCmUmCmAmG * mC * mG * mU * mA * mA * mG * mU * mG * mA * mU * mG * mU * mC * mG * mU * mG * mA * mCmUmGmAmG-3 ‘. Акцепторный MB был помечен флуорофором ATTO647N на 5′-конце и гасителем Iowa Black RQ на 3′-конце и имел последовательность: 5’-mCmUmUmCmG * mU * mC * mC * mA * mC * mA * mA * mA * mC * mA * mC * mA * mA * mC * mU * mC * mC * mU * mGmAmAmG-3 ‘(подчеркнутые буквы обозначают стержень MB, m представляет 2’- O -метильную модификацию РНК; * представляет собой модификацию фосфоротиоатной связи).Последовательности MB предназначены для предотвращения гибридизации с эндогенными РНК в клетках млекопитающих. Все МБ были синтезированы компанией Integrated DNA Technologies (Coralville, IA, USA).

    Культура клеток и трансфекция

    клеток HeLa и U2OS (Американская коллекция типовых культур) культивировали в среде Игла, модифицированной Дульбекко (DMEM, Mediatech), с добавлением 10% (об. / Об.) FBS (PAN ™ Biotech) и 1 × GlutaMAX ™ (Thermo Fisher) при 37 ° C. ° C, 5% (об. / Об.) CO 2 и относительная влажность 90%.Трансфекцию плазмиды проводили FuGENE ® 6 (Promega) в соответствии с протоколами производителя, когда клетки достигли 50-70% конфлюэнтности в 6-луночном планшете. Для визуализации неповторяющихся областей с использованием CRISPR / dual-FRET MB клетки HeLa или U2OS трансфицировали 600 нг BFP / dCas9-C1 и 1400 нг либо одиночной, либо мультиплексной конструкции экспрессии sgRNA (см. Дополнительную таблицу S4). Для экспериментов по совместному мечению клетки трансфицировали 600 нг pCMV-dCas9-EGFP-C1, 600 нг мультиплексированной конструкции экспрессии sgRNA и 600 нг pSLQ1661-sgRNA-rep.Для экспериментов по гибридизации с флуоресценцией in situ клетки HeLa, посеянные на 8-луночное покровное стекло с камерами Lab-Tek ™, предварительно покрытое фибронектином, трансфицировали 60 нг BFP / dCas9-C1, 60 нг pSLQ1661-sgRNA-rep (дистально до ). MUC4 -NRR) и 60 нг pSLQ1661-sgRNA-rep (проксимально к MUC4 -NRR). Все эксперименты проводились с клетками при количестве пассажей от 5 до 25.

    Доставка МБ

    МБ были доставлены в клетки путем нуклеофекции / микропорации в соответствии с методами, описанными ранее (18–20), с модификациями.Вкратце, клетки, выросшие до 70% конфлюэнтности, трипсинизировали, промывали 1 × PBS и осаждали с последующим ресуспендированием в 11 мкл 1 × PBS, содержащего равные количества донорных и акцепторных МБ, для получения конечной концентрации клеток 5000 клеток на мкл и конечная концентрация МБ 2 мкМ для каждого МБ. После этого 10 мкл смеси клеток (примерно 50000 клеток) подвергали нуклеофекции с использованием системы трансфекции Neon ® с параметрами, установленными на уровне 1005 В с длительностью импульса 35 мс и всего двумя импульсами для клеток HeLa и 1230 В с интервалом 10 мс. ширина импульса и всего четыре импульса для ячеек U2OS.После нуклеофекции и трех промывок в культуральной среде для удаления свободных МБ клетки высевали на 8-луночное покровное стекло с камерами Lab-Tek TM , предварительно покрытое фибронектином.

    Следует отметить, что другие методы клеточной доставки, такие как стрептолизин-O (15), также использовались для доставки МБ, и поэтому ожидается, что они будут эффективными для доставки донорных и акцепторных МБ, используемых в этом исследовании.

    Флуоресценция

    in situ гибридизация

    клеток HeLa, содержащих dCas9, sgRNA-rep (дистальный к MUC4 -NRR) и sgRNA-rep (проксимальный к MUC4 -NRR) (см. Дополнительную таблицу S5), подвергали экспериментам по флуоресценции in situ гибридизации (FISH). как описано ранее (3,9), с изменениями.Вкратце, клетки фиксировали 4% параформальдегидом (PFA) в 1 × PBS в течение 30 мин при комнатной температуре с последующими двумя промываниями 1 × PBS. После этого клетки подвергали проницаемости 0,5% (об. / Об.) NP-40 в 1 × PBS в течение 10 мин, а затем промывали один раз 1 × PBS. После 5-минутной инкубации клеток в 1 × PBS клетки инкубировали в буфере для гибридизации (1% (об. / Об.) Tween ® 20, 10% (об. / Об.) Сульфат декстрана, 50% (об. / Об.) об.) формамида, 500 нг / мл ДНК спермы лосося в буфере 2 × солевой раствор цитрата натрия (SSC)), содержащем 100 нМ зондов FISH (5′-CCGTCAATTTACTTTATGTCT-ATTO488-3 ‘) и 100 нМ зондов FISH (5’-TAMRA- CCTCCTGTCACCGAC-3 ‘), нацеленный на повторяющиеся области дистальнее MUC4 -NRR и проксимальнее MUC4 -NRR, соответственно, в увлажненной камере при 37 ° C в течение 24 часов.Клетки промывали в промывочном буфере (2 × SSC, 10% (об. / Об.) Формамид), затем 2 × SSC, 1 × SSC и 0,2 × SSC для удаления негибридизированных зондов, а затем инкубировали в 1 × PBS перед визуализацией. Следует отметить, что взаимодействия между dCas9 и sgRNA приводят к раскручиванию дуплекса ДНК, позволяя зондам FISH гибридизоваться с цепью, не связанной со спейсером sgRNA, без необходимости высокотемпературного нагревания.

    Флуоресцентная микроскопия

    Эксперименты по флуоресцентной микроскопии проводили на моторизованном инвертированном флуоресцентном микроскопе Olympus IX 83, оборудованном системой CellTIRF-4Line, 100 × UPlanSApo 1.Объектив 4NA, камера EMCCD с задней подсветкой (Andor), колеса с фильтром возбуждения и эмиссии Саттера под управлением программного обеспечения CellSens Dimension. Изображения DAPI, EGFP / ATTO488 и TAMRA были получены с использованием набора фильтров Olympus MT20 для DAPI, EGFP и TAMRA, а изображения FRET и ATTO647N были получены с использованием наборов фильтров Chroma (ET545 / 25x, ET700 / 75m, T565lpxr) и (ET620 / 60x, ET700 / 75m, T660lpxr), соответственно, с возбуждающим светом, обеспечиваемым источником света X-Cite Series 120 с ртутной лампой (EXFO).Одновременные двухцветные изображения EGFP и FRET были получены с использованием IX3-U-m4TIR-Sbx и DV2-cube (ET525 / 50m, 585dcxr, ET655lp, Photometrics) с возбуждающим светом EGFP и FRET, обеспечиваемым 488 нм лазерная линия (150 мВт) и лазерная линия 561 нм (150 мВт) соответственно. Пакеты трехмерных (3D) изображений были получены с шагом 0,25 мкм в направлении z. Все изображения были проанализированы с использованием Fiji (21), программы деконволюции AutoQuant (MediaCybernetics) или специально написанных программ MATLAB (версия R2014b, 64-разрядная, Mathworks).

    Идентификация одиночных геномных локусов

    Идентификация отдельных геномных локусов в клетках HeLa и U2OS была выполнена, как описано ранее (18,19), с небольшими модификациями. Короче говоря, вычитание фона катящимся шаром (background = 2) сначала было применено ко всем 3D-изображениям для улучшения твердых частиц. За этим последовала идентификация частиц с помощью плагина 3D Laplacian of Gaussian, доступного для Фиджи. После ручной установки порога для удаления пятен низкой интенсивности вокруг каждого ядра была нарисована область интереса (ROI), которая была применена к отфильтрованному стеку.Подключаемый модуль макроса Find Stack Maxima (Exclude Edge Maxima; Noise Tolerance = 0) затем использовался для определения всех локальных максимумов в каждом срезе z-стека. Чтобы определить, какие двумерные (2D) локальные максимумы были трехмерными локальными максимумами, и количественно оценить общее количество трехмерных локальных максимумов, была написана специальная программа MATLAB для сравнения интенсивности каждого локального максимума в каждом срезе с интенсивностью каждого пикселя в пределах воксельный куб 5 × 5 × 5 с центром вокруг локального максимума. Каждый 3D-максимум считался отдельным локусом и вычислялось общее количество локусов на ядро.

    Трехмерный анализ колокализации

    После определения трехмерных координат геномных локусов в изображениях dCas9-EGFP и dual-FRET MB с использованием методов, описанных выше, была использована специальная программа MATLAB для определения уровня колокализации в трехмерном пространстве, как описано ранее (18,19), с незначительными модификации. Вкратце, трехмерный локальный максимум МБ считался событием колокализации МБ, если трехмерный локальный максимум EGFP был обнаружен в воксельном кубе 7 × 7 × 7 с центром вокруг максимума МБ.Процент совместной локализации рассчитывали путем деления количества событий совместной локализации МБ на общее количество локальных максимумов МБ.

    Анализ отношения сигнал / шум

    2D-изображения были получены как для MB с двойным FRET, так и для одиночных MB с выдержкой в ​​одну секунду и подверглись анализу отношения сигнал / шум (SNR), как описано ранее (22), по следующей формуле:

    $$ \ begin {уравнение *} {\ rm {SNR}} = \ frac {{{{\ rm {i}} _ {{\ rm {spot \ signal, \ maximum}}}} — {{\ rm {i}} _ {{\ rm {background, \ mean}}}}}} {{{{\ rm {i}} _ {{\ rm {background, \ \ sigma}}}}}}} \ end {формула *} $$

    где i точечный сигнал, максимум относится к максимальной интенсивности флуоресценции одного локуса генома, i фон, среднее относится к среднему фоновому сигналу и i фон, σ относится к стандарту отклонение фонового сигнала.

    Анализ с отслеживанием отдельных частиц

    двухмерных покадровых изображений были проанализированы для идентификации треков отдельных геномных локусов с использованием плагина TrackMate от Fiji, как описано ранее (18,19). Вкратце, отдельные пики и их координаты определялись с помощью детектора лапласиана Гаусса (LoG). После этого пики, принадлежащие одному и тому же треку, определялись простым трекером проблем с линейным назначением (LAP). Полученные треки затем использовались для анализа совместного движения и коэффициента диффузии, как описано ниже:

    Анализ совместного движения .Для анализа совместного движения пятна с меткой dCas9-EGFP и пятна с меткой CRISPR / dual-FRET MB использовались одновременные двухцветные изображения, полученные со скоростью 10 кадров в секунду (fps). {1/2}}}} {\ rm {\}} \ end {уравнение * } $$

    , где ρ — коэффициент взаимной корреляции, r EGFP и r FRET — векторы положения пятен с метками dCas9-EGFP и CRISPR / dual-FRET MB. , соответственно.ρ изменяется от -1 для полностью антикоррелированных движений до +1 для полностью коррелированных движений. Анализ коэффициента диффузии . Для анализа коэффициентов диффузии использовались изображения, полученные со скоростью 50 кадров в секунду, с параметрами LAP, установленными на максимальное расстояние связывания = 0,1 мкм; максимальное расстояние закрытия зазора = 0,4 мкм; Максимальный разрыв кадра закрытия промежутка = 4. Результирующие пики и их координаты x y были импортированы в @msdanalyzer, записанный в MATLAB (24), и дорожки, содержащие не менее 15 временных задержек (Δτ), были выбраны для вычисления среднего значения. Квадратное смещение (MSD).\ alpha} \ end {формула *} $$

    с использованием первых 25% общего времени запаздывания с минимальным порогом соответствия R 2 > 0,8. Дорожки с α 1,2 представляли собой направленный транспорт.

    Анализ данных

    Статистический анализ проводили с использованием либо двустороннего критерия Стьюдента t , либо одностороннего дисперсионного анализа с апостериорным тестированием попарных сравнений с использованием критерия Шеффе.

    РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

    Оценка чувствительности CRISPR / dual-FRET MB для визуализации неповторяющихся областей генома

    Мы сконструировали плазмиды, экспрессирующие sgRNA, которые кодируют 1, 2, 3 или 6 уникальных sgRNA_dual-MTS, для мечения неповторяющихся областей гена MUC4 (sgMUC4_dual-MTS) с направленными на ДНК последовательностями спейсера, выбранными из пула 73 MUC4 -нацеливающие sgRNA (4), ранее использовавшиеся для визуализации CRISPR на основе FP (дополнительные таблицы S1 – S4).После котрансфекции модифицированных sgRNAs вместе с dCas9 и BFP (в качестве контроля трансфекции) в клетках HeLa ядерная доставка MB донора FRET, меченного ATTO550, и MB акцептора FRET, меченного ATTO647N, была достигнута посредством нуклеофекции. В качестве контроля клетки также трансфицировали sgRNA_dual-MTS, несущую бессмысленную спейсерную последовательность (sgControl_dual-MTS), и подвергали нуклеофекции с помощью MB. Была выдвинута гипотеза, что если двойной MTS не мешает sgRNA-управляемому связыванию dCas9 с целевым локусом, гибридизация как донорных, так и акцепторных MB с двойным MTS, приводящая к FRET, должна осветить локус MUC4 как яркое пятно. при просмотре с помощью широкопольной флуоресцентной микроскопии.Было обнаружено, что через 24 часа после доставки MB яркие пятна в диапазоне от 1 до 6 копий могут быть обнаружены в 41% и 39% клеток с 6 и 3 sgMUC4_dual-MTS, соответственно (Рисунок 2). Среднее (± стандартное отклонение) число пятен составляло 2,54 ± 0,13 и 2,45 ± 0,11 в клетках с шестью и тремя sgRNA соответственно, что согласуется с ранее сообщенными значениями для локуса MUC4 в клетках HeLa (4,25). Напротив, очень мало пятен было обнаружено в клетках, трансфицированных двумя или одной sgRNA, аналогично результатам, полученным с sgControl_dual-MTS.Поскольку яркие пятна присутствовали в клетках с sgMUC4_dual-MTS, но в очень низкой степени в клетках с контрольной sgRNA, похоже, что наблюдаемые пятна возникают из-за гибридизации MB с комплексами dCas9-sgRNA, связанными с локусом MUC4 , скорее, чем к свободным sgRNA или комплексам dCas9-sgRNA. Подтверждая это, аналогичные эксперименты, проведенные на клетках U2OS, также показали, что CRISPR / dual-FRET MB может освещать неповторяющиеся области MUC4 с тремя уникальными sgMUC4_dual-MTS, но не с sgControl_dual-MTS (дополнительные рисунки S1A и B).Кроме того, сигналы MB с двойным FRET были очень близки к клеточному фону в клетках с тремя немодифицированными sgRNA (без двойной MTS), нацеленными на одни и те же неповторяющиеся области MUC4 и (sgMUC4) (дополнительный рисунок S2), подтверждая, что наблюдаемые пятна в ячейках с тремя уникальными sgMUC4_dual-MTS в результате специфической гибридизации MB с двойным MTS. Доказательства того, что CRISPR / dual-FRET MB действительно может маркировать неповторяющиеся области MUC4 тремя уникальными sgRNA, получены в экспериментах по совместному мечению с использованием dCas9, слитого с EGFP (dCas9-EGFP), и немодифицированной sgRNA (без двойной MTS) нацеливания. повторяющиеся области достаточного размера, необходимые для обнаружения (4), на одной и той же хромосоме (рис. 3A и B).В частности, локализация и движение сигналов MB CRISPR / dual-FRET в высокой степени соответствовали сигналам dCas9-EGFP, когда немодифицированная sgRNA рекрутировала несколько dCas9-EGFP в повторяющиеся области в локусе MUC4 , но не тогда, когда dCas9- EGFP был нацелен на более отдаленные повторяющиеся области (рис. 3C – E, дополнительные рисунки S1C – F, S3 и дополнительные фильмы S1 – S4). Кроме того, CRISPR / dual-FRET MB может также освещать неповторяющиеся области гена MUC1 и межгенную область ДНК (IGR) при использовании трех уникальных MUC1 -нацеливающихся sgRNA_dual-MTS (sgMUC1_dual-MTS) или IGR-targeting. sgRNA_dual-MTS (sgIGR_dual-MTS) соответственно (дополнительные рисунки S4, S5 и дополнительные фильмы S5-S8).Примечательно, что эффективность обнаружения сильно зависела от выбора sgRNA, поскольку второй набор sgRNA давал гораздо более низкую эффективность обнаружения, чем первичный набор (Set I) для каждого локуса (дополнительный рисунок S6), предположительно потому, что не все геномные области одинаково доступны для Комплексы dCas9-sgRNA из-за различий в топологической сложности или наличия ДНК-связывающих белков. Таким образом, необходимо проводить скрининг sgRNA, эффективность обнаружения которых намного превышает фоновый уровень (т. Е.2,3% клеток с неспецифическими пятнами при экспрессии sgControl_dual-MTS, см. Рисунок 2B). Наконец, было достигнуто более низкое отношение сигнал / шум и было обнаружено меньшее количество геномных локусов, когда отдельные МБ были использованы для изображения локусов MUC4 по сравнению с МБ с двойным FRET (дополнительный рисунок S7), что позволяет предположить, что в контексте геномной визуализации подход с двойным FRET MB более чувствителен, чем подход с одним MB, как было замечено в предыдущих исследованиях, когда эти два подхода сравнивались в контексте визуализации РНК (15,16).В совокупности эти результаты показывают, что CRISPR / dual-FRET MB при использовании в сочетании с широкопольной флуоресцентной микроскопией может освещать неповторяющиеся области генома всего с тремя уникальными sgRNA.

    Рисунок 2.

    Отображение неповторяющихся областей MUC4 с помощью CRISPR / dual-FRET MB с различным количеством уникальных MUC4 -нацеливающих sgRNA. Клетки HeLa, экспрессирующие dCas9 и 6, 3, 2 или 1 уникальный sgMUC4_dual-MTS или sgControl_dual-MTS, подвергали нуклеофекции с помощью MB с двойным FRET.Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции. ( A ) Репрезентативные проекционные изображения максимальной интенсивности сигналов MB с двойной FRET в фиксированных ячейках. Шкала 10 мкм. ( B ) Распределение количества точек по ячейкам. На вставке показана эффективность обнаружения. n = 300 клеток из трех независимых экспериментов для каждого условия.

    Рисунок 2.

    Отображение неповторяющихся областей MUC4 с помощью CRISPR / dual-FRET MB с различным количеством уникальных MUC4 -нацеливающих sgRNA.Клетки HeLa, экспрессирующие dCas9 и 6, 3, 2 или 1 уникальный sgMUC4_dual-MTS или sgControl_dual-MTS, подвергали нуклеофекции с помощью MB с двойным FRET. Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции. ( A ) Репрезентативные проекционные изображения максимальной интенсивности сигналов MB с двойной FRET в фиксированных ячейках. Шкала 10 мкм. ( B ) Распределение количества точек по ячейкам. На вставке показана эффективность обнаружения. n = 300 клеток из трех независимых экспериментов для каждого условия.

    Рисунок 3.

    CRISPR / dual-FRET MB может освещать неповторяющиеся области MUC4 с 3 уникальными sgRNA. Клетки HeLa, экспрессирующие dCas9-EGFP, три уникальных sgMUC4_dual-MTS (набор I, см. Дополнительную таблицу S4) и немодифицированную sgRNA, нацеленную на высокоповторяющиеся области генома (sgRNA-rep) на одной и той же хромосоме (Chr3), подвергали нуклеофекции с помощью двойного FRET. МБ. ( A ) Схема эксперимента по совместной маркировке. ( B ) Схема, показывающая положение неповторяющихся областей (NRR) и повторяющихся областей (RR) проксимальнее или дистальнее NRR на Chr3, выбранном для мечения.( C ) Репрезентативные проекционные изображения максимальной интенсивности сигналов MB с двойным FRET и dCas9-EGFP в фиксированных клетках. На вставке показана совместная локализация двух сигналов, когда dCas9-EGFP метит проксимальный RR через sgRNA-rep. Шкала 10 мкм. ( D ) Процент сигналов MB двойного FRET, колокализующихся с сигналами dCas9-EGFP (% MB двойного FRET колокализации), представляющий проксимальный или дистальный RR на клеточной основе (n = 35 клеток для проксимального RR и 30 клеток). клетки для дистального RR). ( E ) Коэффициент корреляции между сигналами двойного FRET MB и dCas9-EGFP (коэффициент совместного движения) в живых клетках.15 траекторий каждого сигнала были проанализированы для проксимального RR и 18 траекторий каждого сигнала были проанализированы для дистального RR, оба из 12 клеток. Обратите внимание, что коэффициент совместного движения 1 указывает на идеальное совместное движение. Все данные представляют собой среднее значение ± стандартное отклонение. трех независимых экспериментов. Звездочки указывают значений P (*** P <0,001).

    Рисунок 3.

    CRISPR / dual-FRET MB может освещать неповторяющиеся области MUC4 с 3 уникальными sgRNA. Клетки HeLa, экспрессирующие dCas9-EGFP, три уникальных sgMUC4_dual-MTS (набор I, см. Дополнительную таблицу S4) и немодифицированную sgRNA, нацеленную на высокоповторяющиеся области генома (sgRNA-rep) на одной и той же хромосоме (Chr3), подвергали нуклеофекции с помощью двойного FRET. МБ.( A ) Схема эксперимента по совместной маркировке. ( B ) Схема, показывающая положение неповторяющихся областей (NRR) и повторяющихся областей (RR) проксимальнее или дистальнее NRR на Chr3, выбранном для мечения. ( C ) Репрезентативные проекционные изображения максимальной интенсивности сигналов MB с двойным FRET и dCas9-EGFP в фиксированных клетках. На вставке показана совместная локализация двух сигналов, когда dCas9-EGFP метит проксимальный RR через sgRNA-rep. Шкала 10 мкм. ( D ) Процент сигналов MB двойного FRET, колокализующихся с сигналами dCas9-EGFP (% MB двойного FRET колокализации), представляющий проксимальный или дистальный RR на клеточной основе (n = 35 клеток для проксимального RR и 30 клеток). клетки для дистального RR).( E ) Коэффициент корреляции между сигналами двойного FRET MB и dCas9-EGFP (коэффициент совместного движения) в живых клетках. 15 траекторий каждого сигнала были проанализированы для проксимального RR и 18 траекторий каждого сигнала были проанализированы для дистального RR, оба из 12 клеток. Обратите внимание, что коэффициент совместного движения 1 указывает на идеальное совместное движение. Все данные представляют собой среднее значение ± стандартное отклонение. трех независимых экспериментов. Звездочки указывают значений P (*** P <0,001).

    Изучение динамики неповторяющихся геномных локусов с использованием CRISPR / dual-FRET MB

    Хроматин очень динамичен и подвержен ремоделированию (26).Следовательно, методика, способная фиксировать движение определенного геномного локуса с высоким пространственно-временным разрешением, должна способствовать углубленной характеристике архитектур генома в реальном времени. Успешно продемонстрировав способность CRISPR / dual-FRET MB для освещения неповторяющихся локусов с помощью трех уникальных sgRNA, мы затем оценили возможности этой стратегии для визуализации динамики хроматина. Чтобы проверить это, мы осветили неповторяющиеся области MUC4, MUC1 и IGR в клетках HeLa, используя CRISPR / dual-FRET MB с тремя sgMUC4_dual-MTS, sgMUC1_dual-MTS и sgIGR_dual-MTS (набор I, см. Дополнительный рисунок. S6) соответственно.Интересно, что анализ отслеживания одиночных частиц показал, что, хотя все обнаруженные локусы демонстрируют диффузное поведение (α <1,2), три разных локуса демонстрируют уникальные диапазоны движения, а также коэффициенты диффузии (рисунок 4 и дополнительные фильмы S9 – S11), предположительно отражая их различия в транскрипционной активности и местной среде (27). Мы должны подчеркнуть, что три sgRNA, используемые для визуализации, предназначенные для нацеливания через ∼770 п.н. в MUC4 , ∼300 п.н. в MUC1 и ∼220 п.н. в IGR, были выбраны на основе доступности смежного мотива протоспейсера (PAM) и спейсера. специфичность.Наш CRISPR / dual-FRET MB также должен позволять визуализировать другие неповторяющиеся области аналогичного или меньшего размера, предлагая возможность для мониторинга архитектуры генома с высокой четкостью и живыми клетками.

    Рисунок 4.

    Динамика одиночных локусов MUC4, MUC1, и IGR, выявленных MB CRISPR / dual-FRET с тремя уникальными sgRNA_dual-MTS. Клетки HeLa, экспрессирующие dCas9 и три уникальных sgMUC4_dual-MTS, sgMUC1_dual-MTS или sgIGR_dual-MTS (набор I), подвергали нуклеофекции с помощью MB с двойным FRET.Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции. ( A ) Репрезентативные траектории отдельных локусов, полученные в течение временного окна 0,5 с. Пунктирные кружки указывают диапазон движения. ( B ) Диаграммы разброса коэффициентов диффузии (D eff ) отдельных локусов. Всего было проанализировано MUC4 (89 траекторий), MUC1 (80 траекторий) и IGR (88 траекторий) из 81, 68 и 75 ячеек соответственно. Все данные представляют собой среднее значение ± S.Э. трех независимых экспериментов. Звездочки обозначают P -значений (** P <0,01, *** P <0,001).

    Рисунок 4.

    Динамика одиночных MUC4, MUC1, и IGR локусов, выявленных с помощью MB CRISPR / dual-FRET с тремя уникальными sgRNA_dual-MTS. Клетки HeLa, экспрессирующие dCas9 и три уникальных sgMUC4_dual-MTS, sgMUC1_dual-MTS или sgIGR_dual-MTS (набор I), подвергали нуклеофекции с помощью MB с двойным FRET. Изображения флуоресцентной микроскопии получали через 24 часа после нуклеофекции.( A ) Репрезентативные траектории отдельных локусов, полученные в течение временного окна 0,5 с. Пунктирные кружки указывают диапазон движения. ( B ) Диаграммы разброса коэффициентов диффузии (D eff ) отдельных локусов. Всего было проанализировано MUC4 (89 траекторий), MUC1 (80 траекторий) и IGR (88 траекторий) из 81, 68 и 75 ячеек соответственно. Все данные представляют собой среднее значение ± стандартное отклонение. трех независимых экспериментов. Звездочки указывают значений P (** P <0.01, *** P <0,001).

    Заключение

    Таким образом, мы объединили CRISPR и MB с двойным FRET для разработки системы CRISPR / dual-FRET MB, которую можно использовать для измерения динамики неповторяющихся участков отдельных геномных локусов в геноме человека всего с тремя уникальными sgRNA. Следует отметить, что в то время как неповторяющиеся области генома ранее визуализировались с помощью основанных на FP подходов к визуализации CRISPR с помощью дифракционно-ограниченной флуоресцентной микроскопии (4,6-8), с одной чувствительной системой, которая использует 4 уникальных sgRNAs, нацеленных на ~ 3800 п.н. MUC4 сообщает о наличии 2.В среднем 2 пятна на клетку (6), каждая sgRNA была экстенсивно модифицирована, чтобы содержать 16 аптамеров MS2 для маркировки 32 копий белка оболочки MS2, слитого с FP (MCP-FP), что вызывает опасения относительно того, обладают ли меченые локусы нормальной физиологической активностью. . Кроме того, необходимость добавления нескольких копий аптамера в тандеме может усложнить клонирование, поскольку плазмиды, кодирующие несколько тандемных повторов, подвержены рекомбинации. Кроме того, комплексы dCas9-sgRNA, меченные множеством FP, могут быть очень чувствительны к агрегации, что приводит к образованию высокоинтенсивных неспецифических точек, которые могут быть ошибочно интерпретированы как геномные локусы (10).Учитывая, что общая масса одного комплекса визуализации CRISPR / dual-FRET MB (∼242 кДа) составляет примерно 14% от общей массы одного комплекса визуализации системы на основе MS2, несущей 32 MCP-FP (∼1,76 МДа) (Дополнительная таблица S7) и обе системы демонстрируют схожую эффективность обнаружения для MUC4 неповторяющихся областей, мы пришли к выводу, что CRISPR / dual-FRET MB является высокочувствительной платформой для визуализации живых клеток неповторяющихся геномных локусов со способностью обеспечивают наиболее точное отображение нормальной динамики хроматина на сегодняшний день.

    Мы также должны подчеркнуть, что, хотя технология CRISPR / dual-FRET MB демонстрирует гораздо большую чувствительность для обнаружения геномных локусов, чем ее родительский подход, в котором используется один MB, она может быть менее применима в исследованиях, где необходимо визуализировать несколько геномных локусов одновременно, поскольку новая технология предполагает наличие двух оптически разных MB для вызова сигнала FRET. Мы предполагаем использование более продвинутых оптических методов, таких как визуализация сверхвысокого разрешения (28) и мультиспектральная визуализация (29), а включение более совершенных пар флуорофор / гаситель может расширить универсальность CRISPR / dual-FRET MB, что позволит проводить исследования как короткие, так и дальние геномные организации, а также их физиологические роли в широком диапазоне пространственных и временных масштабов.

    ДОПОЛНИТЕЛЬНЫЕ ДАННЫЕ

    Дополнительные данные доступны в NAR Online.

    ФИНАНСИРОВАНИЕ

    Национальная программа ключевых исследований и разработок Китая [2016YFA0100702 и 2016YFA0501603]; Национальный фонд естественных наук Китая [31771583]. Финансирование платы за открытый доступ: Национальная программа ключевых исследований и разработок Китая [2016YFA0100702].

    Заявление о конфликте интересов . Ничего не объявлено.

    ССЫЛКИ

    1.

    Knight

    S.

    ,

    Tjian

    R.

    ,

    Doudna

    J.

    Геномы в центре внимания: разработка и применение технологий визуализации Crispr-Cas9

    .

    Angew. Chem. Int. Эд. Англ.

    2017

    ;

    57

    :

    4329

    4337

    ,2.

    Wu

    X.

    ,

    Mao

    S.

    ,

    Ying

    Y.

    ,

    Krueger

    C.J.

    ,

    Чен

    А.К.

    Прогресс и проблемы в области визуализации геномных локусов живых клеток с использованием платформ на основе CRISPR

    .

    Геномика Протеомика Биоинформатика

    .

    2019

    ;

    17

    :

    119

    128

    . 3.

    Chen

    B.

    ,

    Guan

    J.

    ,

    Huang

    B.

    Визуализация специфической геномной ДНК в живых клетках

    .

    Annu. Rev. Biophys.

    2016

    ;

    45

    :

    1

    23

    .4.

    Chen

    B.H.

    ,

    Gilbert

    L.A.

    ,

    Cimini

    B.A.

    ,

    Schnitzbauer

    J.

    ,

    Zhang

    W.

    ,

    Li

    G.W.

    ,

    Park

    J.

    ,

    Blackburn

    E.H.

    ,

    Weissman

    J.S.

    ,

    Ци

    Л.С.

    et al. .

    Динамическое отображение локусов генома в живых клетках человека с помощью оптимизированной системы CRISPR / Cas

    .

    Ячейка

    .

    2013

    ;

    155

    :

    1479

    1491

    . 5.

    Ma

    H.

    ,

    Naseri

    A.

    ,

    Reyes-Gutierrez

    P.

    ,

    Wolfe

    SA

    ,

    Zhang

    S.

    ,

    Pederson

    T.

    Многоцветное CRISPR-мечение хромосомных локусов в клетках человека

    .

    Proc. Natl. Акад. Sci. США

    2015

    ;

    112

    :

    3002

    3007

    .6.

    Qin

    P.W.

    ,

    Parlak

    M.

    ,

    Kuscu

    C.

    ,

    Bandaria

    J.

    ,

    Mir

    M.

    ,

    Szlachta

    K.

    ,

    Singh

    R.

    ,

    Darzacq

    X.

    ,

    Yildiz

    A.

    ,

    Adli

    M.

    Визуализация живых клеток низко- и неповторяющихся хромосомных локусов с использованием CRISPR-Cas9

    .

    Нат. Commun.

    2017

    ;

    8

    :

    14725

    .7.

    Shao

    S.

    ,

    Chang

    L.

    ,

    Sun

    Y.

    ,

    Hou

    Y.

    ,

    Fan

    X.

    ,

    Sun

    Y.

    Мультиплексная экспрессия sgRNA делает возможным универсальное мечение одиночной неповторяющейся ДНК и регуляцию эндогенных генов

    .

    ACS Synth. Биол.

    2018

    ;

    7

    :

    176

    186

    .8.

    Gu

    B.

    ,

    Swigut

    T.

    ,

    Spencley

    A.

    ,

    Bauer

    MR

    ,

    Chung

    M.

    ,

    Meyer

    T.

    ,

    Wysocka

    J.

    Связанные с транскрипцией изменения ядерной подвижности цис-регуляторных элементов млекопитающих

    .

    Наука

    .

    2018

    ;

    359

    :

    1050

    1055

    .9.

    Wu

    X.

    ,

    Mao

    S.

    ,

    Yang

    Y.

    ,

    Rushdi

    M.N.

    ,

    Krueger

    C.J.

    ,

    Chen

    A.K.

    Гибридная система CRISPR / молекулярного маяка для визуализации генома живых клеток

    .

    Nucleic Acids Res.

    2018

    ;

    46

    :

    e80

    .10.

    Hong

    Y.

    ,

    Lu

    G.

    ,

    Duan

    J.

    ,

    Liu

    W.

    ,

    Zhang

    Y.

    Сравнение и оптимизация систем мечения генома CRISPR / dCas9 / gRNA для визуализации живых клеток

    .

    Genome Biol.

    2018

    ;

    19

    :

    39

    . 11.

    Тяги

    S.

    ,

    Kramer

    F.R.

    Молекулярные маяки: зонды, флуоресцирующие при гибридизации

    .

    Нат. Biotechnol.

    1996

    ;

    14

    :

    303

    308

    .12.

    Bao

    G.

    ,

    Rhee

    W.J.

    ,

    Tsourkas

    A.

    Флуоресцентные зонды для обнаружения РНК живых клеток

    .

    Annu. Преподобный Биомед. Англ.

    2009

    ;

    11

    :

    25

    47

    . 13.

    Ma

    Z.

    ,

    Wu

    X.

    ,

    Krueger

    C.J.

    ,

    Chen

    A.K.

    Разработка новых конструкций молекулярных маяков для изучения динамики и локализации внутриклеточной РНК

    .

    Геномика Протеомика Биоинформатика

    .

    2017

    ;

    15

    :

    279

    286

    . 14.

    Zheng

    J.

    ,

    Yang

    R.

    ,

    Shi

    M.

    ,

    Wu

    C.

    ,

    Fang

    X.

    ,

    Li

    Y.

    ,

    Li

    J.

    ,

    Tan

    W.

    Рационально разработанные молекулярные маяки для биоаналитических и биомедицинских приложений

    .

    Chem. Soc. Ред.

    2015

    ;

    44

    :

    3036

    3055

    .15.

    Santangelo

    P.J.

    ,

    Nix

    B.

    ,

    Tsourkas

    A.

    ,

    Bao

    G.

    Двойные молекулярные маяки FRET для обнаружения мРНК в живых клетках

    .

    Nucleic Acids Res.

    2004

    ;

    32

    :

    e57

    . 16.

    Цуркас

    A.

    ,

    Behlke

    M.A.

    ,

    Xu

    Y.

    ,

    Bao

    G.

    Спектроскопические характеристики двойных флуоресцентных / люминесцентных резонансных молекулярных маяков с переносом энергии

    .

    Анал. Chem.

    2003

    ;

    75

    :

    3697

    3703

    0,17.

    van den Bogaard

    P.T.

    ,

    Tyagi

    S.

    Использование молекулярных маяков для изучения распространения мРНП из локуса гена

    .

    Methods Mol.Биол.

    2009

    ;

    464

    :

    91

    103

    0,18.

    Чен

    М.М.

    ,

    млн лет

    Z.

    ,

    Wu

    X.T.

    ,

    Мао

    S.Q.

    ,

    Ян

    Ю.Т.

    ,

    Tan

    J.

    ,

    Krueger

    C.J.

    ,

    Chen

    A.K.

    Подход на основе молекулярных маяков для визуализации транскриптов РНК на живых клетках с минимальной инженерией мишеней на уровне одной молекулы

    .

    Sci. Отчет

    2017

    ;

    7

    :

    1550

    .19.

    Чжао

    Д.

    ,

    Ян

    Ю.Т.

    ,

    Qu

    N.

    ,

    Chen

    M.M.

    ,

    Ma

    Z.

    ,

    Krueger

    C.J.

    ,

    Behlke

    MA

    ,

    Chen

    A.K.

    Обнаружение одной молекулы и отслеживание транскриптов РНК в живых клетках с использованием оптимизированных фосфоротиоатом молекулярных маяков 2′-O-метил РНК

    .

    Биоматериалы

    .

    2016

    ;

    100

    :

    172

    183

    .20.

    Чен

    А.К.

    ,

    Behlke

    M.A.

    ,

    Tsourkas

    A.

    Эффективная цитозольная доставка конъюгатов молекулярных маяков и проточно-цитометрический анализ целевой РНК

    .

    Nucleic Acids Res.

    2008

    ;

    36

    :

    e69

    . 21.

    Schindelin

    J.

    ,

    Arganda-Carreras

    I.

    ,

    Frize

    E.

    ,

    Kaynig

    V.

    ,

    Longair

    M.

    ,

    Pietzsch

    T.

    ,

    Preibisch

    S.

    ,

    Rueden

    C.

    ,

    Saalfeld

    S.

    ,

    Schmid

    B.

    et al. .

    Fiji: платформа с открытым исходным кодом для анализа биологических изображений

    .

    Нат. Методы

    .

    2012

    ;

    9

    :

    676

    682

    .22.

    Chen

    B.

    ,

    Zou

    W.

    ,

    Xu

    H.

    ,

    Liang

    Y.

    ,

    Huang

    B.

    Эффективная маркировка и визуализация белка -кодирование генов в живых клетках с использованием CRISPR-Tag

    .

    Нат. Commun.

    2018

    ;

    9

    :

    5065

    . 23.

    Hunenberger

    P.H.

    ,

    Mark

    A.E.

    ,

    Vangunsteren

    W.F.

    Флуктуационный и кросс-корреляционный анализ белковых движений, наблюдаемых в наносекундном молекулярно-динамическом моделировании

    .

    J. Mol. Биол.

    1995

    ;

    252

    :

    492

    503

    . 24.

    Тарантино

    N.

    ,

    Tinevez

    J.Y.

    ,

    Crowell

    E.F.

    ,

    Boisson

    B.

    ,

    Henriques

    R.

    ,

    Mhlanga

    M.

    ,

    Agou

    F.

    ,

    Israel

    A.

    ,

    Laplantine

    E.

    TNF и IL-1 предъявляют различные потребности в убиквитине для индукции супрамолекулярных структур NEMO-IKK

    .

    J. Cell Biol.

    2014

    ;

    204

    :

    231

    245

    0,25.

    Негембор

    М.В.

    ,

    Себастьян-Перес

    R.

    ,

    Aulicino

    F.

    ,

    Gomez-Garcia

    P.А.

    ,

    Cosma

    М.П.

    ,

    Lakadamyali

    M.

    (Po) STAC (CRISPR, модифицированный полицистронным SunTAg) обеспечивает визуализацию нескольких генов в сверхвысоком разрешении живых и фиксированных клеток

    .

    Nucleic Acids Res.

    2018

    ;

    46

    :

    e30

    .26.

    Soutoglou

    E.

    ,

    Misteli

    T.

    Подвижность и неподвижность хроматина в транскрипции и стабильность генома

    .

    Curr. Opin. Genet. Dev.

    2007

    ;

    17

    :

    435

    442

    0,27.

    Lanctot

    C.

    ,

    Cheutin

    T.

    ,

    Cremer

    M.

    ,

    Cavalli

    G.

    ,

    Cremer

    T.

    Архитектура динамического генома в ядерном пространстве: регулирование экспрессии генов в трех измерениях

    .

    Нат. Преподобный Жене.

    2007

    ;

    8

    :

    104

    115

    .28.

    Sahl

    S.J.

    ,

    Ад

    S.W.

    ,

    Jakobs

    S.

    Флуоресцентная наноскопия в клеточной биологии

    .

    Нат. Rev. Mol. Cell Biol.

    2017

    ;

    18

    :

    685

    701

    ,29.

    Коэн

    S.

    ,

    Valm

    A.M.

    ,

    Lippincott-Schwartz

    J.

    Мультиспектральная визуализация живых клеток

    .

    Curr.Protoc. Cell Biol.

    2018

    ;

    79

    :

    e46

    .

    © Автор (ы) 2019. Опубликовано Oxford University Press от имени Nucleic Acids Research.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа правильно процитирована.

    Тернер и его коллеги используют двумерную электронную спектроскопию для изучения сигналов FRET

    В статье «Двумерная электронная спектроскопия выявляет спектральную динамику ферстеровского резонансного переноса энергии», опубликованной в CHEM (Vol.5 выпуск 8, август 2019 г.) Дэниел Тернер и его коллеги разрабатывают модель подписей FRET в 2D ES, которая помогает отличить их от других сигналов. Первым автором является аспирант химии Нью-Йоркского университета Брайан Петков, к нему присоединились другие докторанты Нью-Йоркского университета Тобиас Геллен, Камилла Фарфан, Уильям Карбери и Белинда Хетцлер. В список авторов включены профессор химии Дженис Калтер из Нью-Йоркского университета Дирк Траунер и доцент Нью-Йоркского университета в Шанхае Уильям Гловер и аспирант Синпин Ли, а также Дарин Улнесс из Университета Миннесоты.

    Реферат: Двумерная электронная спектроскопия (2D ES) исследует энергии хромофоров и их взаимодействие, поэтому этот метод в настоящее время широко используется для изучения механизмов передачи энергии возбуждения. Повсеместное распространение и важность резонансной передачи энергии Фёрстера (FRET) требует тщательного изучения его характеристик в 2D ES. Здесь, используя принципы спектроскопии зашумленного света для учета события спонтанного переноса, мы описываем модель сигналов, которые возникают из FRET в 2D ES.Эта модель дает три теоретических результата относительно пика передачи энергии, которые согласуются с нашими лабораторными измерениями. Второе неожиданное открытие заключается в том, что процессы сольватации, которые вызывают динамический стоксов сдвиг акцепторного сигнала, также вызывают относительно более медленное красное смещение сигнала передачи энергии, обнаруживая фундаментальное различие в релаксации сольватации между фотовозбужденными и возбужденными FRET молекулами акцептора. Подписи, полученные из модели, служат эталоном для текущей работы над механизмами передачи энергии.

    Здесь Тернер и его коллеги разрабатывают модель FRET в 2D ES, основанную на шумном свете, чтобы учесть вибрации, которые ее активируют. Важно отметить, что они выявляют несколько неизвестных особенностей, которые отличают FRET от других сигналов. Эти сигнатуры являются фундаментальными и сразу же применимы к текущей работе над фотосинтетическими комплексами, солнечными наноматериалами и другими основными направлениями возобновляемой энергии. Будущая междисциплинарная работа, начиная от исследований передачи энергии в организмах и заканчивая медицински применимыми методологиями биовизуализации, будет использовать преимущества этих спектральных и временных сигнатур.

    Это исследование было поддержано Национальным научным фондом и Фондом Альфреда П. Слоуна.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.